Team:Newcastle/Promoter Library
From 2009.igem.org
Promoter Library
Introduction
In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement in vivo. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions.
Several efforts to produce parts libraries are currently underway.As part of our contribution to synthetic biology, we decided to create a promoter library for B. subtilis.
Novelty in this sub-project
The novelty in this sub-project lies in the generation of a large number of B. subtilis promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in B. subtilis. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences.
Design
Template used to create the promoter sequences: Prefix...UpSpacer...-35...PromSpacer...-10...DownSpacer..Suffix
- BBPrefix - StandardBioBrickPrefix EcoR1 and Xba1 - gaattcgcggccgcttctagag
- UpSpacer - attta - consensus sigA 5 bases 5'
- -35 - TTGACA
- PromSpacer - length 17 - consensus ttttatttaaattatga
- -10 - TATAAT
- DownSpacer (from ackA)- ggaaaag
- BBSuffix - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag
Variances
We designed three variances to create library of promoters with different strengths.
- Degenerating -35 and -10 sequences.
BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix
- BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix
- BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix
Variance 1
In this variance we only degenerate -35 and -10 sequences.
Variance 2
In the second variance we use N's for the promoter sequence between -35 and -10 regions
Variance 3
Lab Work Strategies
Other Presentations and Diagrams
News
Events
- 20 – 21 June 2009 - Europe workshop (London)
- 23 – 24 June 2009 - UK iGEM meetup (Edinburgh)
- 23 October Practice Presentation (Newcastle)
- 23 October T-shirts are ready
- 27 October Practice Presentation (Sunderland)
- 27 October Poster is ready
- 30 October – 2 November 2009 - Jamboree (Boston)
Social Net
- Newcastle iGEM Twitter
- [http://www.facebook.com/home.php#/group.php?gid=131709337641 Newcastle on Facebook]
- [http://www.youtube.com/user/newcastle2009igem Newcastle Youtube Channel]