User contributions
From 2009.igem.org
(Latest | Earliest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)
- 03:19, 22 October 2009 (diff | hist) Template:WarHead1 (top)
- 03:17, 22 October 2009 (diff | hist) Team:Warsaw/Parts (top)
- 03:10, 22 October 2009 (diff | hist) Team:Warsaw/protocols (→Lab protocols) (top)
- 03:08, 22 October 2009 (diff | hist) Team:Warsaw/Notebook (top)
- 03:02, 22 October 2009 (diff | hist) Team:Warsaw/Human (top)
- 02:16, 22 October 2009 (diff | hist) Team:Warsaw/Biosafety (top)
- 02:11, 22 October 2009 (diff | hist) m Team:Warsaw/Biosafety
- 01:26, 22 October 2009 (diff | hist) Team:Warsaw/results (top)
- 00:26, 22 October 2009 (diff | hist) File:Mareczek.jpg (uploaded a new version of "Image:Mareczek.jpg") (top)
- 00:23, 22 October 2009 (diff | hist) Team:Warsaw/Team (top)
- 00:20, 22 October 2009 (diff | hist) Team:Warsaw/Project/introduction (top)
- 00:18, 22 October 2009 (diff | hist) Team:Warsaw/Project/cytoplasm (top)
- 00:14, 22 October 2009 (diff | hist) N Team:Warsaw/Project/future (New page: {{WarHead1|project=block|team=none|modelling=none|lab=none}} =Future plans= In this place we want to present you how we want to improve our BacInVader system in the future. We've spent h...) (top)
- 23:52, 21 October 2009 (diff | hist) Template:WarHead1
- 23:09, 21 October 2009 (diff | hist) Team:Warsaw/Acknowledgements (→sponsors) (top)
- 23:07, 21 October 2009 (diff | hist) Team:Warsaw (top)
- 20:30, 21 October 2009 (diff | hist) Team:Warsaw/Project/endosome
- 20:23, 21 October 2009 (diff | hist) Template:WarHead1
- 20:21, 21 October 2009 (diff | hist) Team:Warsaw/Project/invasion (top)
- 20:19, 21 October 2009 (diff | hist) N File:War up.png (top)
- 20:15, 21 October 2009 (diff | hist) Team:Warsaw/Project/invasion
- 20:05, 21 October 2009 (diff | hist) Team:Warsaw/Project/invasion
- 19:59, 21 October 2009 (diff | hist) N File:Bacillus invasion.jpg (top)
- 01:20, 21 October 2009 (diff | hist) Team:Warsaw/Biosafety
- 00:43, 21 October 2009 (diff | hist) Team:Warsaw/Biosafety
- 23:45, 20 October 2009 (diff | hist) Team:Warsaw/Sources (top)
- 20:20, 19 October 2009 (diff | hist) Template:WarHead1
- 19:42, 19 October 2009 (diff | hist) Template:WarHead1
- 19:39, 19 October 2009 (diff | hist) Template:WarHead1
- 23:07, 18 October 2009 (diff | hist) Template:WarHead1
- 23:06, 18 October 2009 (diff | hist) Team:Warsaw/Primers
- 23:05, 18 October 2009 (diff | hist) Team:Warsaw/Gallery
- 22:57, 18 October 2009 (diff | hist) Team:Warsaw/Gallery
- 22:53, 18 October 2009 (diff | hist) Team:Warsaw/Gallery
- 22:53, 18 October 2009 (diff | hist) N File:Debata thumb.jpg (top)
- 22:52, 18 October 2009 (diff | hist) N File:Debata.jpg (top)
- 22:52, 18 October 2009 (diff | hist) N File:Debata JarekAsia thumb.jpg (top)
- 22:51, 18 October 2009 (diff | hist) N File:Debata JarekAsia.jpg (top)
- 22:46, 18 October 2009 (diff | hist) N File:Debata Jarek thumb.jpg (top)
- 22:45, 18 October 2009 (diff | hist) N File:Debata Jarek.jpg (top)
- 22:35, 18 October 2009 (diff | hist) Team:Warsaw/Parts
- 22:20, 18 October 2009 (diff | hist) Team:Warsaw/Parts
- 17:23, 18 October 2009 (diff | hist) Team:Warsaw/Parts
- 17:00, 18 October 2009 (diff | hist) Template:WarHead1
- 16:54, 18 October 2009 (diff | hist) Template:WarHead1
- 16:52, 18 October 2009 (diff | hist) Template:WarHead1
- 16:33, 18 October 2009 (diff | hist) Template:WarHead1
- 16:31, 18 October 2009 (diff | hist) N Team:Warsaw/results (New page: {{WarHead1|lab=none|project=none|team=none|modelling=none}} Our zajebiste wykurwiste results {{WarFoot1}})
- 16:29, 18 October 2009 (diff | hist) Team:Warsaw/Project/introduction
- 16:24, 18 October 2009 (diff | hist) Team:Warsaw/Project/introduction
- 15:53, 18 October 2009 (diff | hist) N Team:Warsaw/Project/apoptosis (New page: {{WarHead1|project=block|team=none|modelling=none|lab=none}} ==Induction of [https://2009.igem.org/Team:Warsaw/Glossary#apoptosis apoptosis]== ==Theoretical basis== [[Image:Mito apo.png|...)
- 15:49, 18 October 2009 (diff | hist) Team:Warsaw/Project/cytoplasm
- 15:46, 18 October 2009 (diff | hist) Team:Warsaw/Project/cytoplasm
- 15:43, 18 October 2009 (diff | hist) Team:Warsaw/Project/conjugation
- 15:39, 18 October 2009 (diff | hist) N Team:Warsaw/Project/conjugation (New page: {{WarHead1|project=block|team=none|modelling=none|lab=none}} ==Conjugation with mitochondria== Conjugation with mitochondria is one of ideas how to use our BacInVader system. This is bas...)
- 15:34, 18 October 2009 (diff | hist) Team:Warsaw/Project/endosome
- 15:33, 18 October 2009 (diff | hist) N File:Endosome escape.png (top)
- 14:20, 18 October 2009 (diff | hist) Team:Warsaw/Project/invasion
- 14:20, 18 October 2009 (diff | hist) Team:Warsaw/Project/invasion
- 13:46, 18 October 2009 (diff | hist) Template:WarHead1
- 17:03, 17 October 2009 (diff | hist) Template:WarHead1
- 17:02, 17 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif") (top)
- 16:59, 17 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif")
- 15:37, 16 October 2009 (diff | hist) Template:WarHead1
- 23:39, 15 October 2009 (diff | hist) Template:WarHead1
- 22:47, 15 October 2009 (diff | hist) Template:WarHead1
- 22:44, 15 October 2009 (diff | hist) Template:WarHead1
- 22:42, 15 October 2009 (diff | hist) Template:WarHead1
- 13:02, 15 October 2009 (diff | hist) Team:Warsaw/Glossary
- 12:43, 15 October 2009 (diff | hist) Template:WarHead1
- 12:42, 15 October 2009 (diff | hist) Template:WarHead1
- 12:32, 15 October 2009 (diff | hist) Template:WarHead1
- 11:23, 15 October 2009 (diff | hist) Team:Warsaw/Human
- 10:20, 15 October 2009 (diff | hist) Template:WarHead1
- 10:19, 15 October 2009 (diff | hist) Template:WarHead1
- 10:02, 15 October 2009 (diff | hist) Template:WarHead1
- 10:02, 15 October 2009 (diff | hist) Template:WarHead1
- 09:06, 15 October 2009 (diff | hist) Team:Warsaw/Glossary
- 23:57, 14 October 2009 (diff | hist) Template:WarNotebook (top)
- 23:55, 14 October 2009 (diff | hist) Team:Warsaw
- 23:54, 14 October 2009 (diff | hist) Team:Warsaw/Acknowledgements
- 23:53, 14 October 2009 (diff | hist) Team:Warsaw/Gallery
- 23:53, 14 October 2009 (diff | hist) Team:Warsaw/Human
- 23:53, 14 October 2009 (diff | hist) N Team:Warsaw/Biosafety (New page: {{WarHead1|project=none|team=none|modelling=none|lab=none}})
- 23:53, 14 October 2009 (diff | hist) Team:Warsaw/Glossary
- 23:52, 14 October 2009 (diff | hist) Team:Warsaw/Parts
- 23:52, 14 October 2009 (diff | hist) Team:Warsaw/Resources
- 23:52, 14 October 2009 (diff | hist) Team:Warsaw/protocols
- 23:51, 14 October 2009 (diff | hist) Team:Warsaw/Notebook
- 23:51, 14 October 2009 (diff | hist) Team:Warsaw/Modelling/Structural
- 23:50, 14 October 2009 (diff | hist) Team:Warsaw/Modelling/Apoptosis (top)
- 23:50, 14 October 2009 (diff | hist) Team:Warsaw/Modelling/Gene Networks
- 23:49, 14 October 2009 (diff | hist) N Team:Warsaw/Modelling/Invasiveness (New page: {{WarHead1|project=none|team=none|modelling=block|lab=none}})
- 23:49, 14 October 2009 (diff | hist) Team:Warsaw/Modelling
- 23:49, 14 October 2009 (diff | hist) Team:Warsaw/Team/Pawinskiego
- 23:48, 14 October 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 23:48, 14 October 2009 (diff | hist) Team:Warsaw/Team/Supervisors (top)
- 23:48, 14 October 2009 (diff | hist) Team:Warsaw/Team
- 23:48, 14 October 2009 (diff | hist) Team:Warsaw/Bibliography (top)
- 23:47, 14 October 2009 (diff | hist) Team:Warsaw/Project/detailed
- 23:46, 14 October 2009 (diff | hist) Team:Warsaw/Project/theory
- 23:46, 14 October 2009 (diff | hist) Team:Warsaw/Project/introduction
- 23:44, 14 October 2009 (diff | hist) Team:Warsaw/Project/introduction
- 23:44, 14 October 2009 (diff | hist) Template:WarHead1
- 23:43, 14 October 2009 (diff | hist) Template:WarHead1
- 23:41, 14 October 2009 (diff | hist) Template:WarHead1
- 20:32, 14 October 2009 (diff | hist) Template:WarHead1
- 20:28, 14 October 2009 (diff | hist) Template:WarHead1
- 13:40, 14 October 2009 (diff | hist) Template:WarHead1
- 13:40, 14 October 2009 (diff | hist) Template:WarHead1
- 13:39, 14 October 2009 (diff | hist) Template:WarHead1
- 13:38, 14 October 2009 (diff | hist) Template:WarHead1
- 13:36, 14 October 2009 (diff | hist) Template:WarHead1
- 13:35, 14 October 2009 (diff | hist) Template:WarHead1
- 13:33, 14 October 2009 (diff | hist) Template:WarHead1
- 13:32, 14 October 2009 (diff | hist) Template:WarHead1
- 13:31, 14 October 2009 (diff | hist) Template:WarHead1
- 13:30, 14 October 2009 (diff | hist) Template:WarHead1
- 13:29, 14 October 2009 (diff | hist) Template:WarHead1
- 13:27, 14 October 2009 (diff | hist) Template:WarHead1
- 13:27, 14 October 2009 (diff | hist) m Template:WarHead1
- 13:25, 14 October 2009 (diff | hist) m Template:WarHead1
- 13:25, 14 October 2009 (diff | hist) Template:WarHead1
- 13:11, 14 October 2009 (diff | hist) Template:WarHead1
- 14:07, 13 October 2009 (diff | hist) Template:WarHead1
- 14:05, 13 October 2009 (diff | hist) Template:WarHead1
- 13:59, 13 October 2009 (diff | hist) Template:WarHead1
- 13:58, 13 October 2009 (diff | hist) Template:WarHead1
- 13:58, 13 October 2009 (diff | hist) m Template:WarHead1
- 13:54, 13 October 2009 (diff | hist) m Team:Warsaw/test komorka1 (top)
- 13:40, 13 October 2009 (diff | hist) Template:WarNotebook
- 13:39, 13 October 2009 (diff | hist) Template:WarNotebookEnd (top)
- 13:38, 13 October 2009 (diff | hist) Team:Warsaw/Notebook
- 12:17, 13 October 2009 (diff | hist) Team:Warsaw
- 12:06, 13 October 2009 (diff | hist) Team:Warsaw/Team
- 12:04, 13 October 2009 (diff | hist) Team:Warsaw/Acknowledgements (→sponsors)
- 12:02, 13 October 2009 (diff | hist) Team:Warsaw/Team/Pawinskiego
- 12:01, 13 October 2009 (diff | hist) Template:WarHead1
- 12:01, 13 October 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 11:55, 13 October 2009 (diff | hist) Template:WarHead1
- 11:54, 13 October 2009 (diff | hist) Template:WarHead1
- 11:52, 13 October 2009 (diff | hist) Template:WarHead1
- 11:51, 13 October 2009 (diff | hist) Template:WarHead1
- 11:50, 13 October 2009 (diff | hist) Team:Warsaw
- 11:45, 13 October 2009 (diff | hist) Template:WarHead1
- 11:43, 13 October 2009 (diff | hist) Template:WarHead1
- 11:42, 13 October 2009 (diff | hist) N Template:WarHead1 (Template:WarHead1 moved to Template:WarHead4)
- 11:42, 13 October 2009 (diff | hist) m Template:WarHead4 (Template:WarHead1 moved to Template:WarHead4) (top)
- 23:17, 12 October 2009 (diff | hist) Template:WarHead3 (top)
- 23:16, 12 October 2009 (diff | hist) Team:Warsaw/test komorka1
- 23:15, 12 October 2009 (diff | hist) Team:Warsaw/test warhead3 (top)
- 23:12, 12 October 2009 (diff | hist) Team:Warsaw/test warhead3
- 23:11, 12 October 2009 (diff | hist) Template:WarHead3
- 22:57, 12 October 2009 (diff | hist) N File:War button sub onmouseover.png (top)
- 22:55, 12 October 2009 (diff | hist) N File:War button main onmouseover.png (top)
- 22:44, 12 October 2009 (diff | hist) File:War button main.png (uploaded a new version of "Image:War button main.png") (top)
- 22:39, 12 October 2009 (diff | hist) File:War button main.png (uploaded a new version of "Image:War button main.png")
- 22:36, 12 October 2009 (diff | hist) File:War button main.png (uploaded a new version of "Image:War button main.png")
- 22:33, 12 October 2009 (diff | hist) File:War button main.png (uploaded a new version of "Image:War button main.png")
- 22:25, 12 October 2009 (diff | hist) File:War menu frame bottom.png (uploaded a new version of "Image:War menu frame bottom.png") (top)
- 22:10, 12 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif")
- 22:07, 12 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif")
- 22:06, 12 October 2009 (diff | hist) File:War top.png (uploaded a new version of "Image:War top.png") (top)
- 22:00, 12 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif")
- 21:58, 12 October 2009 (diff | hist) File:War top.png (uploaded a new version of "Image:War top.png")
- 21:50, 12 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif")
- 21:49, 12 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif")
- 21:47, 12 October 2009 (diff | hist) File:War menu frame top.png (uploaded a new version of "Image:War menu frame top.png") (top)
- 21:39, 12 October 2009 (diff | hist) File:War menu frame top.png (uploaded a new version of "Image:War menu frame top.png")
- 21:35, 12 October 2009 (diff | hist) File:War menu frame top.png (uploaded a new version of "Image:War menu frame top.png")
- 21:30, 12 October 2009 (diff | hist) File:War menu frame top.png (uploaded a new version of "Image:War menu frame top.png")
- 21:13, 12 October 2009 (diff | hist) File:War top.png (uploaded a new version of "Image:War top.png")
- 21:06, 12 October 2009 (diff | hist) File:War top.png (uploaded a new version of "Image:War top.png")
- 20:47, 12 October 2009 (diff | hist) Template:WarHead3
- 20:45, 12 October 2009 (diff | hist) File:War div frame bottom.png (uploaded a new version of "Image:War div frame bottom.png") (top)
- 20:45, 12 October 2009 (diff | hist) File:War div frame top.png (uploaded a new version of "Image:War div frame top.png") (top)
- 20:43, 12 October 2009 (diff | hist) File:War div frame.png (uploaded a new version of "Image:War div frame.png") (top)
- 20:37, 12 October 2009 (diff | hist) File:War div frame.png (uploaded a new version of "Image:War div frame.png")
- 20:23, 12 October 2009 (diff | hist) File:War div frame.png (uploaded a new version of "Image:War div frame.png")
- 20:19, 12 October 2009 (diff | hist) Template:WarHead3
- 20:19, 12 October 2009 (diff | hist) File:War div frame bottom.png (uploaded a new version of "Image:War div frame bottom.png")
- 20:18, 12 October 2009 (diff | hist) File:War div frame top.png (uploaded a new version of "Image:War div frame top.png")
- 20:17, 12 October 2009 (diff | hist) File:War div frame.png (uploaded a new version of "Image:War div frame.png")
- 20:09, 12 October 2009 (diff | hist) File:War background.gif (uploaded a new version of "Image:War background.gif") (top)
- 23:12, 7 October 2009 (diff | hist) Template:WarHead3
- 22:45, 7 October 2009 (diff | hist) N Team:Warsaw/test warhead3 (New page: {{WarHead3}} __NOTOC__ <div style="font-family: arial black; font-size: 26px; text-align: center; font-weight: bold;">Sponsor us!!!</div> <div class="war_paragra...)
- 22:42, 7 October 2009 (diff | hist) Template:WarHead3
- 22:29, 7 October 2009 (diff | hist) Template:WarHead3
- 22:26, 7 October 2009 (diff | hist) Template:WarHead3
- 22:19, 7 October 2009 (diff | hist) File:War button main.png (uploaded a new version of "Image:War button main.png")
- 22:17, 7 October 2009 (diff | hist) File:War button main.png (uploaded a new version of "Image:War button main.png")
- 22:16, 7 October 2009 (diff | hist) File:War button sub.png (uploaded a new version of "Image:War button sub.png") (top)
- 21:43, 7 October 2009 (diff | hist) N File:War button sub.png
- 21:42, 7 October 2009 (diff | hist) N File:War button main.png
- 21:30, 7 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif")
- 21:28, 7 October 2009 (diff | hist) File:War menu frame bottom.png (uploaded a new version of "Image:War menu frame bottom.png")
- 21:27, 7 October 2009 (diff | hist) File:War menu frame.gif (uploaded a new version of "Image:War menu frame.gif")
- 21:23, 7 October 2009 (diff | hist) File:War menu frame top.png (uploaded a new version of "Image:War menu frame top.png")
- 21:21, 7 October 2009 (diff | hist) N File:War top.png
- 21:05, 7 October 2009 (diff | hist) N File:War menu frame.gif
- 21:04, 7 October 2009 (diff | hist) N File:War menu frame bottom.png
- 21:03, 7 October 2009 (diff | hist) N File:War menu frame top.png
- 20:52, 7 October 2009 (diff | hist) N File:War div frame.png
- 20:50, 7 October 2009 (diff | hist) N File:War div frame bottom.png
- 20:48, 7 October 2009 (diff | hist) N File:War div frame top.png
- 20:18, 7 October 2009 (diff | hist) N File:War background.gif
- 16:21, 6 October 2009 (diff | hist) Jamboree/Schedule/Practice sessions
- 16:21, 6 October 2009 (diff | hist) Jamboree/Schedule/Practice sessions
- 15:36, 4 October 2009 (diff | hist) Team:Warsaw
- 23:54, 30 September 2009 (diff | hist) Template:WarHead4
- 23:36, 30 September 2009 (diff | hist) Template:WarHead3
- 23:36, 30 September 2009 (diff | hist) File:Okienko dol.jpg (uploaded a new version of "Image:Okienko dol.jpg") (top)
- 23:36, 30 September 2009 (diff | hist) File:Okienko srodek.jpg (uploaded a new version of "Image:Okienko srodek.jpg") (top)
- 23:32, 30 September 2009 (diff | hist) File:Okienko gora.jpg (uploaded a new version of "Image:Okienko gora.jpg") (top)
- 23:28, 30 September 2009 (diff | hist) Template:WarHead3
- 23:25, 30 September 2009 (diff | hist) N Template:WarHead3 (New page: <html> <style> - →here is the place for your styles (to be approved by Pawel): .important { font-family: "Verdana"; text-align: justify; font-weight: bold; font-size: 15...)
- 23:25, 30 September 2009 (diff | hist) N File:Okienko dol.jpg
- 23:22, 30 September 2009 (diff | hist) N File:Okienko srodek.jpg
- 23:20, 30 September 2009 (diff | hist) N File:Okienko gora.jpg
- 17:20, 26 September 2009 (diff | hist) Template:WarHead4
- 17:18, 26 September 2009 (diff | hist) Team:Warsaw/Modelling
- 17:16, 26 September 2009 (diff | hist) N Team:Warsaw/Modelling (Team:Warsaw/Modelling moved to Team:Warsaw/Modelling/Apoptosis)
- 17:16, 26 September 2009 (diff | hist) m Team:Warsaw/Modelling/Apoptosis (Team:Warsaw/Modelling moved to Team:Warsaw/Modelling/Apoptosis)
- 08:37, 25 September 2009 (diff | hist) Template:WarHead4
- 08:35, 25 September 2009 (diff | hist) Team:Warsaw/Acknowledgements
- 08:33, 25 September 2009 (diff | hist) Team:Warsaw
- 08:59, 23 September 2009 (diff | hist) Team:Warsaw/Acknowledgements
- 08:58, 23 September 2009 (diff | hist) N File:Logo LOT.jpg (top)
- 21:20, 21 September 2009 (diff | hist) Team:Warsaw/Acknowledgements
- 21:18, 21 September 2009 (diff | hist) m Team:Warsaw
- 17:12, 21 September 2009 (diff | hist) Team:Warsaw/test komorka1
- 17:08, 21 September 2009 (diff | hist) Team:Warsaw
- 17:08, 21 September 2009 (diff | hist) Team:Warsaw/Gallery
- 16:59, 21 September 2009 (diff | hist) N File:ProfSzybalski thumb.jpg (top)
- 16:59, 21 September 2009 (diff | hist) N File:ProfSzybalski.jpg (top)
- 16:59, 21 September 2009 (diff | hist) N File:Team z profSzybalskim thumb.jpg (top)
- 16:59, 21 September 2009 (diff | hist) N File:Team z profSzybalskim1 thumb.jpg (top)
- 16:58, 21 September 2009 (diff | hist) N File:Team z profSzybalskim1.jpg (top)
- 16:58, 21 September 2009 (diff | hist) N File:Team z profSzybalskim.jpg (top)
- 22:13, 20 September 2009 (diff | hist) Team:Warsaw/Project/invasion
- 21:56, 20 September 2009 (diff | hist) N File:Invasion.jpg (top)
- 15:08, 20 September 2009 (diff | hist) Team:Warsaw/test komorka1
- 13:48, 20 September 2009 (diff | hist) Team:Warsaw/Project/invasion
- 13:23, 20 September 2009 (diff | hist) N Team:Warsaw/Project/cytoplasm (New page: {{WarHead1}} ===The cytoplasmic operon.=== Fig 4. Overview of endosomal detection operon. <br> Fig 4. Overview of endosomal detection operon. It is composed of YFP – ...)
- 13:13, 20 September 2009 (diff | hist) N Team:Warsaw/Project/secretion (New page: {{WarHead1}} ==Protein secretion== ===Theoretical basis=== Free living bacteria make use of diverse transport and secretion systems. In gram negative bacteria [https://2009.igem.org/Team:...) (top)
- 13:12, 20 September 2009 (diff | hist) N Team:Warsaw/Project/endosome (New page: {{WarHead1}} ==Escape from the phagosome== ==Theoretical basis== Although the induction of phagocytosis and entrance into the eukaryotic cell seems to be simple, this is not the final st...)
- 13:09, 20 September 2009 (diff | hist) N Team:Warsaw/Project/invasion (New page: {{WarHead1}} ==Entrance of bacteria into eukaryotic cells== ==Theoretical basis== Many bacterial species are capable of entering mammalian cells. One of the crucial proteins for this pro...)
- 13:04, 20 September 2009 (diff | hist) Team:Warsaw/Acknowledgements
- 10:34, 20 September 2009 (diff | hist) m Team:Warsaw/test komorka1
- 09:10, 20 September 2009 (diff | hist) Team:Warsaw/test komorka1
- 00:15, 20 September 2009 (diff | hist) Team:Warsaw/test komorka1
- 00:12, 20 September 2009 (diff | hist) Team:Warsaw/Gallery
- 00:00, 20 September 2009 (diff | hist) N File:Room136 thumb.jpg (top)
- 23:59, 19 September 2009 (diff | hist) N File:Room136.jpg (top)
- 23:55, 19 September 2009 (diff | hist) N File:Kuba Marcin thumb.jpg (top)
- 23:55, 19 September 2009 (diff | hist) N File:Kuba Marcin.jpg (top)
- 23:37, 19 September 2009 (diff | hist) Team:Warsaw/Gallery
- 23:25, 19 September 2009 (diff | hist) N File:Warsaw meeting2 thumb.jpg (top)
- 23:25, 19 September 2009 (diff | hist) N File:Warsaw meeting2.jpg (top)
- 23:22, 19 September 2009 (diff | hist) Team:Warsaw/Gallery
- 23:20, 19 September 2009 (diff | hist) N File:Franek mysli thumb.jpg (top)
- 23:20, 19 September 2009 (diff | hist) N File:Franek mysli.jpg (top)
- 22:51, 19 September 2009 (diff | hist) N File:Warsaw meeting1 thumb.jpg (top)
- 22:51, 19 September 2009 (diff | hist) N File:Warsaw meeting1.jpg (top)
- 22:36, 19 September 2009 (diff | hist) Team:Warsaw/test komorka1
- 22:30, 19 September 2009 (diff | hist) File:Kom3aa.png (uploaded a new version of "Image:Kom3aa.png") (top)
- 22:17, 19 September 2009 (diff | hist) N File:Kom dark.png (top)
- 22:10, 19 September 2009 (diff | hist) File:Kom1a.png (uploaded a new version of "Image:Kom1a.png") (top)
- 22:05, 19 September 2009 (diff | hist) N Team:Warsaw/test komorka1 (New page: {{WarHead1}} <html> <head> <style> div.komHide { background-repeat:no-repeat; position:absolute; visibility:hidden; } .komVisible { background-repeat:no-repeat; position:absolute; curs...)
- 22:05, 19 September 2009 (diff | hist) N File:Kom4ba.png (top)
- 22:04, 19 September 2009 (diff | hist) N File:Kom3ba.png (top)
- 22:04, 19 September 2009 (diff | hist) N File:Kom3aa.png
- 22:03, 19 September 2009 (diff | hist) N File:Kom2a.png (top)
- 22:01, 19 September 2009 (diff | hist) N File:Kom1a.png
- 21:58, 19 September 2009 (diff | hist) Team:Warsaw/test komorka (top)
- 21:47, 19 September 2009 (diff | hist) Team:Warsaw/test komorka
- 21:30, 19 September 2009 (diff | hist) Team:Warsaw/test komorka
- 21:29, 19 September 2009 (diff | hist) Team:Warsaw/test komorka
- 21:25, 19 September 2009 (diff | hist) Team:Warsaw/test komorka
- 21:22, 19 September 2009 (diff | hist) Team:Warsaw/test komorka
- 21:19, 19 September 2009 (diff | hist) Team:Warsaw/test komorka
- 20:56, 19 September 2009 (diff | hist) Team:Warsaw/test komorka
- 20:48, 19 September 2009 (diff | hist) Team:Warsaw/test komorka
- 20:44, 19 September 2009 (diff | hist) File:Pixel.gif (uploaded a new version of "Image:Pixel.gif") (top)
- 19:46, 19 September 2009 (diff | hist) File:Kom1.png (uploaded a new version of "Image:Kom1.png") (top)
- 19:42, 19 September 2009 (diff | hist) File:Blacknwhite.png (uploaded a new version of "Image:Blacknwhite.png") (top)
- 19:41, 19 September 2009 (diff | hist) File:Kom4b.png (uploaded a new version of "Image:Kom4b.png") (top)
- 19:41, 19 September 2009 (diff | hist) File:Kom3b.png (uploaded a new version of "Image:Kom3b.png") (top)
- 19:41, 19 September 2009 (diff | hist) File:Kom3a.png (uploaded a new version of "Image:Kom3a.png") (top)
- 19:40, 19 September 2009 (diff | hist) File:Kom2.png (uploaded a new version of "Image:Kom2.png") (top)
- 19:40, 19 September 2009 (diff | hist) File:Kom1.png (uploaded a new version of "Image:Kom1.png")
- 19:34, 19 September 2009 (diff | hist) File:Kom colour.png (uploaded a new version of "Image:Kom colour.png") (top)
- 19:29, 19 September 2009 (diff | hist) N File:Pixel.gif
- 19:10, 19 September 2009 (diff | hist) Template:WarHead4
- 19:07, 19 September 2009 (diff | hist) Template:WarHead4
- 19:07, 19 September 2009 (diff | hist) Template:WarHead4
- 19:06, 19 September 2009 (diff | hist) Template:WarHead4
- 19:06, 19 September 2009 (diff | hist) Template:WarHead4
- 19:05, 19 September 2009 (diff | hist) Template:WarHead4
- 19:03, 19 September 2009 (diff | hist) Template:WarHead4
- 13:04, 19 September 2009 (diff | hist) Team:Warsaw/Calendar-Main/6 September 2009 (top)
- 13:03, 19 September 2009 (diff | hist) Team:Warsaw/Calendar-Main/6 September 2009
- 09:49, 18 September 2009 (diff | hist) Team:Warsaw
- 09:48, 18 September 2009 (diff | hist) Team:Warsaw
- 09:44, 18 September 2009 (diff | hist) Team:Warsaw/Primers
- 22:06, 17 September 2009 (diff | hist) Team:Warsaw/Acknowledgements
- 22:06, 17 September 2009 (diff | hist) N Team:Warsaw/Acknowledgements (New page: {{WarHead1}} =Acknowledgements= Place for a lot of nice words directed to everyone who helps us. Citing Marcin: "dziękujemy wszystkim pracownikom IGiBu, że jeszcze nas nie wyp*** stamt...)
- 22:04, 17 September 2009 (diff | hist) Template:WarHead4
- 20:38, 17 September 2009 (diff | hist) Team:Warsaw/Calendar-Main/9 September 2009 (top)
- 15:35, 16 September 2009 (diff | hist) Template:WarNotebook
- 07:30, 16 September 2009 (diff | hist) Template:WarHead4 (Undo revision 68803 by Smaegol (Talk))
- 07:26, 16 September 2009 (diff | hist) Template:WarHead4
- 07:16, 16 September 2009 (diff | hist) Team:Warsaw/Primers
- 07:08, 16 September 2009 (diff | hist) Team:Warsaw/protocols
- 00:46, 16 September 2009 (diff | hist) Team:Warsaw/test komorka
- 00:44, 16 September 2009 (diff | hist) Team:Warsaw/test komorka
- 00:32, 16 September 2009 (diff | hist) Team:Warsaw/test komorka
- 00:28, 16 September 2009 (diff | hist) File:Kom1.png (uploaded a new version of "Image:Kom1.png")
- 00:07, 16 September 2009 (diff | hist) Team:Warsaw/test komorka
- 23:21, 15 September 2009 (diff | hist) File:Kom4b.png (uploaded a new version of "Image:Kom4b.png")
- 22:34, 15 September 2009 (diff | hist) N File:Kom4b.png
- 22:32, 15 September 2009 (diff | hist) N File:Kom3b.png
- 22:25, 15 September 2009 (diff | hist) N File:Kom3a.png
- 22:16, 15 September 2009 (diff | hist) File:Kom2.png (uploaded a new version of "Image:Kom2.png")
- 22:15, 15 September 2009 (diff | hist) N File:2.png
- 20:44, 15 September 2009 (diff | hist) File:Kom1.png (uploaded a new version of "Image:Kom1.png")
- 13:35, 15 September 2009 (diff | hist) Team:Warsaw/Sources
- 13:08, 15 September 2009 (diff | hist) Team:Warsaw/Sources
- 12:49, 15 September 2009 (diff | hist) N Team:Warsaw/Sources (New page: {{WarHead1}} =Sources of natural bricks= Below we present sources of bricks prepared by our team. ==Invasiveness bricks== Most of bricks connected with bacteria invasiveness were acquir...)
- 11:40, 15 September 2009 (diff | hist) Team:Warsaw/Resources
- 11:38, 15 September 2009 (diff | hist) Team:Warsaw/Primers
- 11:32, 15 September 2009 (diff | hist) Team:Warsaw/Primers
- 11:10, 15 September 2009 (diff | hist) Team:Warsaw/Primers
- 20:08, 14 September 2009 (diff | hist) Team:Warsaw/test komorka
- 17:29, 14 September 2009 (diff | hist) Team:Warsaw/test komorka
- 16:43, 14 September 2009 (diff | hist) Team:Warsaw/test komorka
- 16:25, 14 September 2009 (diff | hist) Team:Warsaw/test komorka
- 16:19, 14 September 2009 (diff | hist) N File:Kom colour.png
- 15:22, 14 September 2009 (diff | hist) Team:Warsaw/test komorka
- 15:20, 14 September 2009 (diff | hist) N Team:Warsaw/test komorka (New page: {{Warhead1}} <html> <style> #gmap {display:block; width:714px; height:651px; background:url(https://static.igem.org/mediawiki/2009/6/67/Blacknwhite.png); position:relative; margin:0 auto 2em ...)
- 15:19, 14 September 2009 (diff | hist) N File:Kom8.png (top)
- 15:18, 14 September 2009 (diff | hist) N File:Kom7.png (top)
- 15:17, 14 September 2009 (diff | hist) N File:Kom6.png (top)
- 15:15, 14 September 2009 (diff | hist) N File:Kom4.png (top)
- 14:49, 14 September 2009 (diff | hist) N File:Kom2.png
- 14:49, 14 September 2009 (diff | hist) N File:Kom1.png
- 14:45, 14 September 2009 (diff | hist) N File:3.png
- 14:29, 14 September 2009 (diff | hist) N File:5.png
- 14:27, 14 September 2009 (diff | hist) N File:Blacknwhite.png
- 15:08, 11 September 2009 (diff | hist) Team:Warsaw/Project/detailed
- 13:37, 11 September 2009 (diff | hist) Team:Warsaw/Project/theory
- 12:49, 11 September 2009 (diff | hist) Team:Warsaw/Glossary
- 12:31, 11 September 2009 (diff | hist) Team:Warsaw/Project/introduction
- 12:14, 11 September 2009 (diff | hist) Team:Warsaw
- 23:01, 10 September 2009 (diff | hist) N Team:Warsaw/Notebook/toc (New page: {{WarHead1}} Table of Contents<br/> (or short description of what are we trying to do) 1. Cloning of natural bricks: * PhoP/PhoQ operon + mgtc promoter * Mitochondrium-targeting sequence...) (top)
- 17:04, 9 September 2009 (diff | hist) Team:Warsaw
- 12:41, 6 September 2009 (diff | hist) Team:Warsaw/Team
- 15:04, 4 September 2009 (diff | hist) Team:Warsaw
- 15:02, 4 September 2009 (diff | hist) N File:CLONTECH LOGO CapCMYK small.jpg (top)
- 15:01, 4 September 2009 (diff | hist) Team:Warsaw/sponsors
- 08:04, 3 September 2009 (diff | hist) Team:Warsaw
- 08:03, 3 September 2009 (diff | hist) Team:Warsaw
- 18:11, 26 August 2009 (diff | hist) Team:Warsaw
- 18:10, 26 August 2009 (diff | hist) Team:Warsaw
- 08:49, 20 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/19 August 2009
- 11:50, 19 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/17 August 2009
- 11:47, 19 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/18 August 2009
- 15:52, 16 August 2009 (diff | hist) m Team:Warsaw/Glossary
- 15:51, 16 August 2009 (diff | hist) Team:Warsaw/Glossary
- 15:39, 16 August 2009 (diff | hist) Team:Warsaw/Project/detailed
- 14:13, 14 August 2009 (diff | hist) m Template:WarNotebook
- 20:56, 13 August 2009 (diff | hist) N Team:Warsaw/Notebook/phoP (New page: {{WarHead1}} ==Preparation of PhoP/PhoQ (BBa_xxxxxx) brick== Persons responsible: Kamila, etc Notebook entries: # [https://2009.igem.org/Team:Warsaw/Calendar-Main/29_April_2009] # [http...) (top)
- 20:38, 13 August 2009 (diff | hist) Template:WarNotebook (Undo revision 45844 by Smaegol (Talk))
- 20:37, 13 August 2009 (diff | hist) Template:WarNotebook (Replacing page with '{{WarHead1}}')
- 19:58, 13 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/2 August 2009
- 19:55, 13 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/3 August 2009
- 19:23, 13 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/11 August 2009
- 19:03, 13 August 2009 (diff | hist) Team:Warsaw/Calendar-Main/13 August 2009
- 19:00, 13 August 2009 (diff | hist) N Team:Warsaw/Primers (New page: {{WarHead1}} <html> <br> <h1>Primers</h1> <h2>cloning primers</h2> <h4>cloning primers</h4> <pre> <a name="croboxF">croboxF</a> 5' ATCTAGATACCTCTGGCGGTGATACTAGTGT 3' <a name="crob...)
- 17:59, 13 August 2009 (diff | hist) Team:Warsaw/Glossary
- 17:48, 13 August 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 17:48, 13 August 2009 (diff | hist) Template:WarFoot1 (top)
- 17:47, 13 August 2009 (diff | hist) File:Portret.jpg (uploaded a new version of "Image:Portret.jpg") (top)
- 17:47, 13 August 2009 (diff | hist) File:Kama igem.jpg (uploaded a new version of "Image:Kama igem.jpg") (top)
- 17:46, 13 August 2009 (diff | hist) File:IMG 1656igem.jpg (uploaded a new version of "Image:IMG 1656igem.jpg") (top)
- 17:38, 13 August 2009 (diff | hist) m Team:Warsaw
- 17:36, 13 August 2009 (diff | hist) Team:Warsaw
- 17:25, 13 August 2009 (diff | hist) Team:Warsaw
- 16:10, 13 August 2009 (diff | hist) Team:Warsaw/Project/theory
- 16:03, 13 August 2009 (diff | hist) N Team:Warsaw/Glossary (New page: {{WarHead1}} __NOTOC__ ==Glossary== ====apoptosis==== <div class="glossary_text">Apoptosis is a natural process of programmed cell death. Apoptosis can be induced by many factors and it...)
- 15:57, 13 August 2009 (diff | hist) Template:WarHead4
- 15:57, 13 August 2009 (diff | hist) Template:WarHead4
- 15:49, 13 August 2009 (diff | hist) Template:WarHead4
- 15:28, 13 August 2009 (diff | hist) File:Stepien fotos 2005 009.jpg (uploaded a new version of "Image:Stepien fotos 2005 009.jpg") (top)
- 15:22, 13 August 2009 (diff | hist) Template:WarFoot1
- 14:54, 13 August 2009 (diff | hist) File:War header3.jpg (uploaded a new version of "Image:War header3.jpg") (top)
- 13:24, 13 August 2009 (diff | hist) Template:WarNotebook (Undo revision 45259 by Smaegol (Talk))
- 13:07, 13 August 2009 (diff | hist) Team:Warsaw/Parts (Replacing page with '{{WarHead1}} Our parts can be found [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2009&group=Warsaw here] {{WarFoot1}}')
- 13:01, 13 August 2009 (diff | hist) Team:Warsaw
- 13:01, 13 August 2009 (diff | hist) Template:WarHead4
- 12:59, 13 August 2009 (diff | hist) Team:Warsaw/sponsors
- 12:59, 13 August 2009 (diff | hist) Team:Warsaw
- 12:55, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:54, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:54, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:50, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:49, 13 August 2009 (diff | hist) Template:WarFoot1
- 12:48, 13 August 2009 (diff | hist) Template:WarNotebook
- 12:29, 13 August 2009 (diff | hist) Template:WarNotebook
- 12:29, 13 August 2009 (diff | hist) Template:WarHead (top)
- 12:26, 13 August 2009 (diff | hist) Template:WarNotebookEnd
- 12:25, 13 August 2009 (diff | hist) Template:WarNotebookEnd
- 12:22, 13 August 2009 (diff | hist) Template:WarHead4
- 12:19, 13 August 2009 (diff | hist) Template:WarNotebook
- 12:04, 13 August 2009 (diff | hist) Template:WarHead4
- 17:35, 11 August 2009 (diff | hist) File:War header3.jpg (uploaded a new version of "Image:War header3.jpg")
- 17:33, 11 August 2009 (diff | hist) Template:WarHead4
- 17:23, 11 August 2009 (diff | hist) N File:War header3.jpg
- 17:12, 11 August 2009 (diff | hist) Template:WarHead4
- 17:12, 11 August 2009 (diff | hist) File:Spacer.jpg (uploaded a new version of "Image:Spacer.jpg") (top)
- 17:03, 11 August 2009 (diff | hist) N File:Spacer.jpg
- 16:59, 11 August 2009 (diff | hist) File:War header2.jpg (uploaded a new version of "Image:War header2.jpg") (top)
- 16:57, 11 August 2009 (diff | hist) Template:WarHead4
- 16:56, 11 August 2009 (diff | hist) File:War header2.jpg (uploaded a new version of "Image:War header2.jpg")
- 16:55, 11 August 2009 (diff | hist) File:War header2.jpg (uploaded a new version of "Image:War header2.jpg")
- 16:37, 11 August 2009 (diff | hist) File:War header2.jpg (uploaded a new version of "Image:War header2.jpg")
- 16:33, 11 August 2009 (diff | hist) N File:War header2.jpg
- 22:31, 6 August 2009 (diff | hist) Team:Warsaw/Notebook/toctest (top)
- 22:30, 6 August 2009 (diff | hist) N Team:Warsaw/Notebook/toctest (New page: {{{WarHead1}} ==Lab work - detailed plan and its execution== ====My idea is....==== Here should be placed sth like schema describing what are we doing, step by step... # Brainstorming ...)
- 07:12, 23 July 2009 (diff | hist) Template:WarHead
- 07:10, 23 July 2009 (diff | hist) Team:Warsaw
- 07:07, 23 July 2009 (diff | hist) N File:Eurx.jpg (top)
- 07:26, 22 July 2009 (diff | hist) Team:Warsaw/Notebook
- 23:10, 21 July 2009 (diff | hist) Template:WarHead4
- 23:07, 21 July 2009 (diff | hist) Team:Warsaw/Team/Supervisors
- 22:32, 21 July 2009 (diff | hist) Team:Warsaw/test2 (top)
- 22:32, 21 July 2009 (diff | hist) Team:Warsaw/test2
- 22:28, 21 July 2009 (diff | hist) N Team:Warsaw/Contact (New page: {{WarHead1}} ==Contact== You can contact us at [mailto:igem2009.warsaw@gmail.com igem2009.warsaw@gmail.com]. We are open for any comments or questions. This e-mail address is also ready...) (top)
- 22:24, 21 July 2009 (diff | hist) Template:WarHead4
- 22:20, 21 July 2009 (diff | hist) N Team:Warsaw/Resources (New page: {{WarHead1}} ==Resources== This is the place when we place different resources connected with our project. It can include some DNA sequences (like primers, vectors, parts, etc) or other t...)
- 22:18, 21 July 2009 (diff | hist) N Team:Warsaw/protocols (New page: {{WarHead1}} ==Lab protocols== __TOC__ ==introduction== Here is the place for the all protocols used by the Warsaw Team during the iGEM 2009. Feel free to add yours. Please be sure to ...)
- 22:15, 21 July 2009 (diff | hist) Template:WarHead4
- 22:15, 21 July 2009 (diff | hist) Team:Warsaw/Notebook
- 22:14, 21 July 2009 (diff | hist) Template:WarHead4
- 22:11, 21 July 2009 (diff | hist) Team:Warsaw/Modelling/Apoptosis
- 22:10, 21 July 2009 (diff | hist) Team:Warsaw/Team/Supervisors
- 22:10, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 22:09, 21 July 2009 (diff | hist) Team:Warsaw/Team/Pawinskiego
- 22:09, 21 July 2009 (diff | hist) Team:Warsaw/Team/Pawinskiego
- 22:00, 21 July 2009 (diff | hist) Team:Warsaw/Team/Pawinskiego
- 22:00, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 22:00, 21 July 2009 (diff | hist) Team:Warsaw/Team/Supervisors
- 21:57, 21 July 2009 (diff | hist) Template:WarHead4
- 21:51, 21 July 2009 (diff | hist) Template:WarHead4
- 21:50, 21 July 2009 (diff | hist) N Team:Warsaw/Modelling/Apoptosis (New page: {{WarHead1}} Ania is person responsible for modelling in our team. She will post some text here ASAP. {{WarFoot1}})
- 21:49, 21 July 2009 (diff | hist) N Team:Warsaw/Bibliography (New page: {{WarHead1}} ==REFERENCES== #Bielecki J, Youngman P, Connelly P, Portnoy DA. Bacillus subtilis expressing a haemolysin gene from Listeria monocytogenes can grow in mammalian cells. Nature...)
- 21:48, 21 July 2009 (diff | hist) N Team:Warsaw/Project/detailed (New page: {{WarHead1}} ==Detailed research project== __TOC__ ===Introduction=== Fig 1. The overview of the system.<br> Fig 1. The overview of the system. Gene regulatory network ...)
- 21:43, 21 July 2009 (diff | hist) N Team:Warsaw/Project/theory (New page: {{WarHead1}} ==Theoretical basis== __TOC__ ===Entrance of bacteria into eukaryotic cells=== Many bacterial species are able to invade an eukaryotic cell. One of the crucial proteins for ...)
- 21:43, 21 July 2009 (diff | hist) Template:WarHead4
- 21:41, 21 July 2009 (diff | hist) Team:Warsaw/Project/introduction
- 21:39, 21 July 2009 (diff | hist) Template:WarHead4
- 21:37, 21 July 2009 (diff | hist) Template:WarHead4
- 21:36, 21 July 2009 (diff | hist) Team:Warsaw/Project/introduction
- 21:36, 21 July 2009 (diff | hist) Template:WarHead4
- 21:34, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:33, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:33, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:32, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:32, 21 July 2009 (diff | hist) Template:WarHead4
- 21:28, 21 July 2009 (diff | hist) Template:WarHead4
- 21:28, 21 July 2009 (diff | hist) Template:WarHead4
- 21:24, 21 July 2009 (diff | hist) Template:WarHead4
- 21:24, 21 July 2009 (diff | hist) Template:WarHead4
- 21:21, 21 July 2009 (diff | hist) Template:WarHead4 (Undo revision 24804 by Smaegol (Talk))
- 21:21, 21 July 2009 (diff | hist) Template:WarHead4
- 21:19, 21 July 2009 (diff | hist) Template:WarHead4
- 21:18, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:17, 21 July 2009 (diff | hist) Template:WarHead4
- 21:16, 21 July 2009 (diff | hist) Template:WarHead4
- 21:15, 21 July 2009 (diff | hist) N Team:Warsaw/Project/introduction (New page: {{WarHead1}} ==Aims of the project== One of the most important challenges in the field of modern medicine is to invent the efficacious anticancer therapy. The gene therapy appears to be th...)
- 21:14, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:14, 21 July 2009 (diff | hist) Template:WarHead4
- 21:12, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:10, 21 July 2009 (diff | hist) Template:WarFoot1
- 21:09, 21 July 2009 (diff | hist) Team:Warsaw/Team
- 20:34, 21 July 2009 (diff | hist) Template:WarFoot1
- 20:31, 21 July 2009 (diff | hist) N Template:WarFoot1 (New page: </div> <div id="footer" style="align:center;"> ---- (C) iGEM 2009 Warsaw Team </div>)
- 20:27, 21 July 2009 (diff | hist) Team:Warsaw/Project (top)
- 19:32, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 19:31, 21 July 2009 (diff | hist) Team:Warsaw/Team
- 19:30, 21 July 2009 (diff | hist) Team:Warsaw/Team
- 19:12, 21 July 2009 (diff | hist) N Team:Warsaw/Team/Pawinskiego (New page: {{WarHead1}} __NOTOC__ ==Pawinskiego group== <div style="text-align: justify;">We are working at the Institute of Biochemistry and Biophysics PAS building, in the laboratory equiped by th...)
- 19:12, 21 July 2009 (diff | hist) Template:WarHead4
- 19:11, 21 July 2009 (diff | hist) Template:WarHead4
- 16:52, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 16:50, 21 July 2009 (diff | hist) Template:WarHead4
- 16:50, 21 July 2009 (diff | hist) Team:Warsaw/Team/Miecznikowa
- 16:49, 21 July 2009 (diff | hist) N Team:Warsaw/Team/Miecznikowa (New page: {{WarHead1}} ==Miecznikowa group== We are working at the Faculty of Biology building, in the laboratory equiped by the Department of Virology and Department of Applied Microbiology. Our wo...)
- 16:02, 21 July 2009 (diff | hist) Template:WarHead4
- 16:02, 21 July 2009 (diff | hist) Template:WarHead4
(Latest | Earliest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)