Team:Paris/Freezer

From 2009.igem.org

(Difference between revisions)

Latest revision as of 15:29, 19 October 2009

Menu accordéon avec jQuery

Freezer

Color code for sticker
Vector	Insert	PCR product	Plasmid	Strains	Kanamycin	Ampicilin	Chloranphenicol

@@ Line 1: / Line 1: @@
+<span/ id="bottom">[https://2009.igem.org/ iGEM ] > [[Team:Paris#top | Paris]] > [[Team:Paris/Freezer#top | Freezer]] > [[Team:Paris/Freezer#bottom | Main]]
 {{Template:Paris2009}}
 {{Template:Paris2009_menu}}
 ==Freezer==
-*[[Team:Paris/Freezer#Primers | Primers]]
-*[[Team:Paris/Freezer#PCR_products | PCR products]]
-*[[Team:Paris/Freezer#Plasmids:_MiniPrep_Products | Plasmids: MiniPrep Products]]
-*[[Team:Paris/Freezer#Digestion_Products | Digestion Products]]
-*[[Team:Paris/Freezer#Unexpected_digestion_results | Unexpected digestion results]]
-*[[Team:Paris/Freezer#Strains_(Glycerol stock) | Strains (Glycerol stock)]]
-*Color code for sticker
-**<span style="background-color:#FF0000">Vector</span>
-**<span style="background-color:#FFFF00">Insert</span>
-**<span style="background-color:#660099">PCR product</span>
-**<span style="background-color:#FF6600">Plasmid</span>
-**<span style="background-color:#006400">Kanamycin</span>
-**<span style="background-color:#3333FF">Ampicilin</span>
-**<span style="background-color:#FF0066">Chloranphenicol</span>
 <html>
-</div>
+<style type="text/css">
-<div id="paris_content_boxtop">
+#left-side {
-</div>
+    position: absolute;
-<div id="paris_content">
+    height: 23px;
-</html>
+    width: 30px;
+    top: 0px;
+    left: 10px;
+    margin-top:10px;
+    padding-top: 7px;
+    background: url(https://static.igem.org/mediawiki/2009/1/1b/Left_menu_pari.png);
+    z-index:4;
+}
-== Primers ==
+#middle-side {
-{|
+    height: 25px;
-! colspan="6" style="background: #c5c5c5;" | [O1] Rev P1
+    width: 650px;
-|- style="background: #cbcee0;"
+    position: absolute;
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
+    top: 0px;
-|width=700px| tolR
+    left: 30px;
-|- style="background: #cbcee0;"
+    margin-top:10px;
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
+    padding-top: 5px;
-|TCTGCTGCAGCGGCCGCTACTAGTATTAGTAAGGCACATCTTTTGCGCCACCG
+    background: #dadada;
-|- style="background: #cbcee0;"
+    z-index:5;
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
+}
-|D. Bikard
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
-|}
+#right-side {
+    position: absolute;
+    height: 23px;
+    width: 30px;
+    margin-top:10px;
+    padding-top: 7px;
+    top: 0px;
+    left: 670px;
+    background: url(https://static.igem.org/mediawiki/2009/4/40/Right_menu_paris.png);
+    z-index:4;
+}
-{|
+a.menu_sub {
-! colspan="6" style="background: #c5c5c5;" | [O2] Fwd P2
+    padding-left: 7px;
-|- style="background: #cbcee0;"
+    padding-right: 7px;
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
+}
-|width=700px| tolR (DO NOT USE ERROR)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|TCTGGAATTCGCGGCCGCTTCTAGATGAAATCAACATTGTACCGTTGCTGGACGTACTG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|D. Bikard
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
-|}
+a.menu_sub_active {
-{|
+    padding-left: 7px;
-! colspan="6" style="background: #c5c5c5;" | [O3] Rev P3
+    padding-right: 7px;
-|- style="background: #cbcee0;"
+    color:#b0310e;
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
+    font-weight:bold;
-|width=700px| tolA
+}
-|- style="background: #cbcee0;"
+</style>
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
+<div id="left-side"></div>
-|TCTGCTGCAGCGGCCGCTACTAGTATTATTACGGTTTGAAGTCCAATGGCG
+<div id="middle-side"><center>
-|- style="background: #cbcee0;"
+<a class="menu_sub_active"href="https://2009.igem.org/Team:Paris/Freezer#bottom"> Main </a>|
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
+<a class="menu_sub" href="https://2009.igem.org/Team:Paris/Freezer_PCR_products#bottom"> PCR Products</a>|
-|D. Bikard
+<a class="menu_sub"href="https://2009.igem.org/Team:Paris/Freezer_Plasmids#bottom"> Plasmids</a>|
-|- style="background: #cbcee0;"
+<a class="menu_sub"href="https://2009.igem.org/Team:Paris/Freezer_Digestion_Products#bottom"> Digestion Products</a>|
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
+<a class="menu_sub"href="https://2009.igem.org/Team:Paris/Freezer_Strains_(Glycerol_stock)#bottom"> Strains (Glycerol stock)</a>|
-|}
+<a class="menu_sub"href="https://2009.igem.org/Team:Paris/constructions#bottom"> Constructions in progress</a>
+</center>
-{|
-! colspan="6" style="background: #c5c5c5;" | [O4] Rev P4
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| tolA (ERROR: Not designed for N-term fusion)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|TCTGGAATTCGCGGCCGCTTCTAGAATGGGTAATACTAAAAACAATGGCGC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|D. Bikard
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O5] Rev P5
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| tatABC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|TCTGCTGCAGCGGCCGCTACTAGTATTATTATTCTTCAGTTTTTTCGCTTTCTGC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|D. Bikard
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [06] Fwd P6
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| tatABC (without RBS)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|TCTGGAATTCGCGGCCGCTTCTAGAATGGGTGGTATCAGTATTTGG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|D. Bikard
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O7] Rev P7
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| clyA fusion
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|TTTCTGCAGCGGCCGCTACTAGTGACTTCAGGTACCTCAAAGAGTGTC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|D. Bikard
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O8] Fwd P8
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| clyA fusion (ERROR: No poly-Gly linker)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|TTTGAATTCGCGGCCGCTTCTAGAATGACTGAAATCGTTGCAGATAAAA
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|D. Bikard
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O9] clyA_Rw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| clyA
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGACTTCAGGTACCTCAAAGAG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O10] clyA_fusion_polyG_Rw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| clyA fusion (with 5-Gly linker)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCCTGCAGCGGCCGCTACTAGTGCCGCCGCCGCCGCCGACTTCAGGTACCTCAAAGAG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O11] ompA_signal_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ompA signal for export to periplasm - from expression vector RBS as in pIN-III-ompA-2 vector - keeps vector original RBS
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAACGAGGGCAAAAAATGAAAAAG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O12] ompA_signal_fusion_Rw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ompA signal for export to periplasm - from expression vector pIN-III-ompA-2 - original RBS from the vector
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCCTGCAGCGGCCGCTACTAGTGGCCTGCGCTACGGTAGCGAAAC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O13] tolR_II_Fusion_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| For fusion of tolR domain II (standard 23)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGGTCGATCTGCCAGACGCTAC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O14] tatABC_RBS_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| Amplification from tatA - contains RBS
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGATGGGTGGTATCAGTATTTGG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O15] TE3_fusion_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| Fusion of N-term domain of colicin E3 (standard 23)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCGAATTCGCGGCCGCTTCTAGAAGCGGTGGCGATGGACGCGGCCATAAC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O16] TE3_Rw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| Amplification of N-term domain of colicin E3 (standard 23)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGCGTTCATAATTTCGCTCAG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O17] Tg3p_Rw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| Amplification of N-term domain of M13's g3p
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAACACTGAGTTTCGTCACCAGTAC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O18] Tg3p_fusion_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| Fusion of N-term domain of M13's g3p (standard 23)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCGAATTCGCGGCCGCTTCTAGAAAAAAATTATTATTCGCAATTCCTTTAG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O19] g3p_F
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| g3p
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCTCCGCTGAAACTGTTGAAAGTTG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O20] g3p_R
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| g3p
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAAGACTCCTTATTACGCAG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O21] Ompa_linker_F
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| For standardisation of OmpA linker (BBaK103006)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGAAAGCTACTAAACTGGTACTGG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O22] Ompa_linker_R
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| For standardisation of OmpA linker (BBaK103006)
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCCTGCAGCGGCCGCTACTAGTAGAGCTCCCTCCTCCAGAACC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O23] OmpAsignal-TE3_seq_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ???
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|CACAAATAGCGAAAGATGAC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O24] OmpAsignal-TE3_seq_Rw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ???
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|ATCATCTGCGGGTAATGATG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O25] VAMP2_Seq_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ???
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|ACTCACTATAGGGAGACCACA
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O26] VAMP2_Seq_Rv
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ???
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GGGCTTTGTTAGCAGCCGGAT
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O27] ClyA_seq_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ???
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GCAGCTATTTCCAGTCACAG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O28] ClyA_seq_Rw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ???
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|CGCCCGCAGCAATAGAATAG
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O29] PFecA_Fw
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ???
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTACGCGGTACTGGATAAACATTTC
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-{|
-! colspan="6" style="background: #c5c5c5;" | [O30] PFecA_Rv
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-|width=700px| ???
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
-|GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTTTGTTGTGTTCAGCTATGAGT
-|- style="background: #cbcee0;"
-|style="background:#0d3e99; color:white; text-align: right;"|Designer
-|G. Cambray
-|- style="background: #cbcee0;"
-!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
-|}
-<html>
 </div>
-<div id="paris_content_boxtop">
-</div>
-<div id="paris_content">
-</html>
-== PCR products ==
+<div id="right-side"></div>
-{|
-|- style="background: #ccccff;"
-! colspan="10" style="background: #ccccff;"|PCR products
-|- style="background: #ccccff; text-align: center;"
-|width=5%| Number
-|width=10%| Name
-|width=12.5%| Oligo F
-|width=12.5%| Oligo R
-|width=10%| Matrix
-|width=5%| Length
-|width=25%| Comments
-|width=5%| Product Left ?
-|width=5%| []ng/µL
-|width=5%| Date
-|}
-http://parts.mit.edu/r/parts/images/partbypart/icon_terminator.png
-http://parts.mit.edu/images/partbypart/icon_regulatory.png
-http://parts.mit.edu/r/parts/images/partbypart/icon_rbs.png
-http://parts.mit.edu/r/parts/images/partbypart/icon_reporter.png
-http://parts.mit.edu/registry/images/7/7b/Part_icon_cds.png
-http://parts.mit.edu/registry/images/9/9f/Part_icon_dna.png
-http://parts.mit.edu/registry/images/2/2e/Part_icon_generator.png
-http://parts.mit.edu/registry/images/a/ab/Part_icon_plasmid.png
-<html>
-</div>
-<div id="paris_content_boxtop">
-</div>
-<div id="paris_content">
-</html>
-== Plasmids: MiniPrep Products ==
-{|
-|- style="background: #c5c5c5;"
-! colspan="5" style="background: #c5c5c5;" | Plasmids: MiniPrep Products
-|- style="background: #0d3e99; text-align: center; color:white;"
-|width=5%| Number
-|width=25%| Name
-|width=50%| Description
-|width=15%| Products in use
-|width=5%| Date
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P1
-|width=25%| pSB2K3
-|width=50%| General plasmid for cloning step after PCR
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P2
-|width=25%| Bba-J61002
-|width=50%| Plasmid backbone, it allows us to change promoter RFP as promoter
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P3
-|width=25%| Bba-J32015
-|width=50%| PelB leader sequence
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P4
-|width=25%| Bba-B0014
-|width=50%| Double terminator bidirectionnal (B0012-B0011)
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P5
-|width=25%| Bba-I14032
-|width=50%| pLac
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P6
-|width=25%| BBa_K103006
-|width=50%| OmpA linker (464bp)
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P7
-|width=25%| Bba-R0040
-|width=50%| TetR repressible promoter
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P8
-|width=25%| Bba-I0500
-|width=50%| ??
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #ccccff; text-align: center;"
-|width=5%| P9
-|width=25%| ??
-|width=50%| ???
-|width=15%| Products in use
-|width=5%| [https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|}
-<html>
-</div>
-<div id="paris_content_boxtop">
-</div>
-<div id="paris_content">
-</html>
-== Digestion Products ==
-<div style="background-color:#FF0000; padding:1px; margin:1px; font-size:120%; text-align:center; font-weight:bold; border:1px solid black">Red = Vector</div>
-<div style="background-color:#FFFF00; padding:1px; margin:1px; font-size:120%; text-align:center; font-weight:bold; border:1px solid black">Yellow = Insert</div>
-{|
-|- style="background: #c5c5c5;"
-! colspan="10" style="background: #c5c5c5;" | Digestion Products
-|- style="background: #0d3e99; text-align: center; color:white;"
-|width=5%| Number
-|width=20%| Product Name
-|width=20%| Matrix Name
-|width=5%| Enz. 1
-|width=5%| Enz. 2
-|width=5%| Size
-|width=20%| Description
-|width=10%| Product Left
-|width=5%| []ng/µL
-|width=5%| Date
-|- style="background: #ccccff; text-align: center;"
-|style="background:#FFFF00"| D1
-| ???
-| ???
-| XbaI
-| PstI
-| Size
-| ???
-| ???
-| ???
-| [https://2009.igem.org/Team:Paris/4_August_2009 08/04]
-|- style="background: #ccccff; text-align: center;"
-|style="background:#FFFF00"| D2
-| ???
-| ???
-| XbaI
-| PstI
-| Size
-| ???
-| ???
-| ???
-| [https://2009.igem.org/Team:Paris/4_August_2009 08/04]
-|- style="background: #ccccff; text-align: center;"
-|style="background:#FFFF00"| D3
-| ???
-| ???
-| XbaI
-| PstI
-| Size
-| ???
-| ???
-| ???
-| [https://2009.igem.org/Team:Paris/4_August_2009 08/04]
-|- style="background: #ccccff; text-align: center;"
-|style="background:#FFFF00"| D4
-| ???
-| ???
-| XbaI
-| PstI
-| Size
-| ???
-| ???
-| ???
-| [https://2009.igem.org/Team:Paris/4_August_2009 08/04]
-|- style="background: #ccccff; text-align: center;"
-|style="background:#FFFF00"| D5
-| ???
-| ???
-| XbaI
-| PstI
-| Size
-| ???
-| ???
-| ???
-| [https://2009.igem.org/Team:Paris/4_August_2009 08/04]
-|- style="background: #ccccff; text-align: center;"
-|style="background:#FFFF00"| D6
-| ???
-| ???
-| XbaI
-| PstI
-| Size
-| ???
-| ???
-| ???
-| [https://2009.igem.org/Team:Paris/4_August_2009 08/04]
-|- style="background: #ccccff; text-align: center;"
-|style="background:#FFFF00"| D7
-| ???
-| ???
-| XbaI
-| PstI
-| Size
-| ???
-| ???
-| ???
-| [https://2009.igem.org/Team:Paris/4_August_2009 08/04]
-|}
-<html>
-</div>
-<div id="paris_content_boxtop">
-</div>
-<div id="paris_content">
-</html>
-== Unexpected digestion results ==
-{|
-|- style="background: #c5c5c5;"
-! colspan="7" style="background: #c5c5c5;" | Digestion Products
-|- style="background: #0d3e99; text-align: center; color:white;"
-|width=5%| Number
-|width=30%| Matrix Name
-|width=5%| Enz. 1
-|width=5%| Enz. 2
-|width=10%| Expected Size
-|width=40%| Description
-|width=5%| Date
-|}
-<html>
-</div>
-<div id="paris_content_boxtop">
-</div>
-<div id="paris_content">
 </html>
-== Strains (Glycerol stock) ==
+<br>
 {|
 |- style="background: #c5c5c5;"
-! colspan="5" style="background: #c5c5c5;" | Strains glycerol stock
+! colspan="8" style="background:#c5c5c5; text-align: center" | Color code for sticker
-|- style="background: #0d3e99; text-align: center; color:white;"
+|- style="background: #0d3e99; text-align: center; color:black;"
-|width=5%| Number
+|width=10% style="background: #FF0000;"| Vector
-|Width=2%|R
+|width=10% style="background: #FFFF00;"| Insert
-|width=25%| Name
+|width=10% style="background: #660099;"| PCR product
-|width=55%| Description
+|width=10% style="background: #FF6600;"| Plasmid
-|width=5%| Date
+|width=10% style="background: #FFFFFF;"| Strains
-|- style="background: #cbcee0; text-align: center;"
+|width=10% style="background: #006400;"| Kanamycin
-|<strike>[https://2009.igem.org/Team:Paris/Strains#Strain_1 S1]</strike>
+|width=10% style="background: #3333FF;"| Ampicilin
-|style="background:#cccccc;"|
+|width=10% style="background: #FF0066;"| Chloranphenicol
-|<strike>DH5&alpha;</strike>
-|<strike>DH5&alpha; E. Coli strain for chimically competent</strike>
-|[https://2009.igem.org/Team:Paris/20_July_2009 07/20]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_2 S2]
-|style="background:#006400;"|K
-|K12 MG 1655 &Delta;recA::Kan
-|Standard E.Coli strain, Kan resistance
-|[https://2009.igem.org/Team:Paris/20_July_2009 07/20]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_3 S3]
-|style="background:#006400;"|K
-|W3110 &Delta;nlp1
-|From Daniel Rodriguez, Kan resistance
-|[https://2009.igem.org/Team:Paris/23_July_2009 07/23]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#TOP10 TOP10]
-|style="background:#cccccc;"|
-|TOP10
-|Competent bacteria
-|[https://2009.igem.org/Team:Paris/27_July_2009 07/27]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_4 S4]
-|style="background:#cccccc;"|
-|TB28
-|No kanamycin resistance
-|[https://2009.igem.org/Team:Paris/29_July_2009 07/29]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_5 S5]
-|style="background:#006400;"|K
-|MG4
-|Strain needs to be grown on media with [NaCl]>=0.5%, preferably 1%NaCl
-|[https://2009.igem.org/Team:Paris/29_July_2009 07/29]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_6 S6]
-|style="background:#cccccc;"|
-|DH5&alpha;
-|DH5&alpha; E. Coli strain for chimically competent (Pasteur)
-|[https://2009.igem.org/Team:Paris/30_July_2009 07/30]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_7 S7]
-|style="background:#3333FF;"|A
-|DH5&alpha;(g3p)
-|DH5&alpha; E. Coli strain with g3p in plasmid, Amp resistance
-|[https://2009.igem.org/Team:Paris/30_July_2009 07/30]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_8 S8]
-|style="background:#006400;"|K
-|DH5&alpha;(pSB2K3)
-|DH5&alpha; E. Coli strain with pSB2K3 plasmid, Kan resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_9 S9]
-|style="background:#3333FF;"|A
-|DH5&alpha;(BBa_J61002)
-|DH5&alpha; E. Coli strain with BBa_J61002 in plasmid, Amp resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_10 S10]
-|style="background:#006400;"|K
-|DH5&alpha;(BBa_J32015)
-|DH5&alpha; E. Coli strain with BBa_J32015 in plasmid, Kan resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_11 S11]
-|style="background:#006400;"|K
-|DH5&alpha;(BBa_B0014)
-|DH5&alpha; E. Coli strain with BBa_B0014 in plasmid, Kan resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_12 S12]
-|style="background:#006400;"|K
-|DH5&alpha;(BBa_I14032)
-|DH5&alpha; E. Coli strain with BBa_I14032 in plasmid, Kan resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_13 S13]
-|style="background:#006400;"|K
-|DH5&alpha;(BBa_K103006)
-|DH5&alpha; E. Coli strain with BBa_K103006 in plasmid, Kan resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_14 S14]
-|style="background:#3333FF;"|A
-|DH5&alpha;(BBa_R0040)
-|DH5&alpha; E. Coli strain with BBa_R0040 in plasmid, Amp resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_15 S15]
-|style="background:#006400;"|K
-|DH5&alpha;(BBa_10500)
-|DH5&alpha; E. Coli strain with BBa_10500 in plasmid, Kan resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_16 S16]
-|style="background:#006400;"|K
-|DH5&alpha;(&Delta;N-Syn1A)
-|DH5&alpha; E. Coli strain with &Delta;N-Syn1A in plasmid, Kan resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_17 S17]
-|style="background:#3333FF;"|A
-|DH5&alpha;(His6-SNAP25)
-|DH5&alpha; E. Coli strain with His6-SNAP25 in plasmid, Amp resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
-|- style="background: #cbcee0; text-align: center;"
-|[https://2009.igem.org/Team:Paris/Strains#Strain_18 S18]
-|style="background:#3333FF;"|A
-|DH5&alpha;(Vamp2-His6)
-|DH5&alpha; E. Coli strain with Vamp2-His6 in plasmid, Amp resistance
-|[https://2009.igem.org/Team:Paris/3_August_2009 08/03]
 |}