|
|
CAROL
Diluting Primers and Primer Extension Polymerase Chain Reaction (PCR)
- To create the synthetic sigma 70 promoter library, we have synthesized 32 different primers (16 different forward primers and 16 different reverse primers) to hopefully form 256 different promoters.
- Need to dilute primers to 80μM. The following is the concentration of the original primers that were synthesized once water was added to the primers.
| Primer | 260/280 | 260/230 | Concentration [ng/μL] | Reading/2.5 [ng/μL] | Stock Concentration [μM] | Volume stock into working [μL] | Volume water into working [μL] |
|
| sig70-F1 | 1.98 | 1.73 | 20816 | 832.64 | 60.07 | 6.7 | 43.3
|
| sig70-F2 | 1.55 | 1.80 | 44284 | 17713.6 | 1277.91 | 3.1 | 46.9
|
| sig70-F3 | 1.62 | 1.86 | 41323 | 16529.2 | 1192.46 | 3.4 | 46.6
|
| sig70-F4 | 1.70 | 1.99 | 32365 | 12946 | 933.96 | 4.3 | 45.7
|
| sig70-F5 | 1.72 | 2.07 | 33688 | 13475.2 | 972.14 | 4.1 | 45.9
|
| sig70-F6 | 2.07 | 1.95 | 45412 | 18164.8 | 1310.46 | 3.1 | 46.9
|
| sig70-F7 | 1.64 | 1.95 | 39046 | 15618.4 | 1126.76 | 3.6 | 46.4
|
| sig70-F8 | 1.43 | 1.63 | 45745 | 18298 | 1320.07 | 3.0 | 47.0
|
| sig70-F9 | 1.75 | 2.16 | 23628 | 9451.2 | 681.84 | 5.9 | 44.1
|
| sig70-F10 | 1.72 | 2.01 | 32682 | 13072.8 | 943.11 | 4.2 | 45.8
|
| sig70-F11 | 1.71 | 2.07 | 31494 | 12597.6 | 908.83 | 4.4 | 45.6
|
| sig70-F12 | 1.59 | 1.82 | 41202 | 16480.8 | 1188.97 | 3.4 | 46.6
|
| sig70-F13 | 1.73 | 2.03 | 29224 | 11689.6 | 843.3 | 4.7 | 45.3
|
| sig70-F14 | 1.41 | 1.58 | 45645 | 18258 | 1317.2 | 3.0 | 47.0
|
| sig70-F15 | 1.59 | 1.85 | 40681 | 16272.4 | 1173.9 | 3.4 | 46.6
|
| sig70-F16 | 1.57 | 1.82 | 42241 | 16896.4 | 1219.0 | 3.3 | 46.7
|
| sig70-R1 | 2.06 | 2.17 | 7516 | 3006.4 | 216.9 | 18.4 | 31.6
|
| sig70-R2 | 2.04 | 2.25 | 15255 | 6102.0 | 440.2 | 9.1 | 40.9
|
| sig70-R3 | 1.76 | 1.85 | 42503 | 17001.2 | 1226.5 | 3.3 | 46.7
|
| sig70-R4 | 2.01 | 2.21 | 24012 | 9604.8 | 692.9 | 5.8 | 44.2
|
| sig70-R5 | 2.10 | 2.27 | 18530 | 7412 | 534.7 | 7.5 | 42.5
|
| sig70-R6 | 1.98 | 2.19 | 28452 | 11380.8 | 821.0 | 4.9 | 45.1
|
| sig70-R7 | 1.94 | 2.17 | 32976 | 13190.4 | 951.6 | 4.2 | 45.8
|
| sig70-R8 | 2.00 | 2.20 | 25379 | 10151.6 | 732.4 | 5.5 | 44.5
|
| sig70-R9 | 2.00 | 2.24 | 24141 | 9656.4 | 696.6 | 5.9 | 44.1
|
| sig70-R10 | 1.94 | 2.17 | 30237 | 12094.8 | 872.6 | 4.6 | 45.4
|
| sig70-R11 | 1.92 | 2.16 | 31497 | 12598.8 | 908.9 | 4.4 | 45.6
|
| sig70-R12 | 1.92 | 2.17 | 30045 | 12018 | 867.0 | 4.6 | 45.4
|
| sig70-R13 | 2.01 | 2.18 | 18726 | 7490.4 | 540.4 | 7.4 | 42.6
|
| sig70-R14 | 1.88 | 2.03 | 36111 | 14444.4 | 1042.1 | 3.8 | 46.2
|
| sig70-R15 | 1.98 | 2.17 | 10679 | 4271.6 | 308.2 | 13 | 37
|
| sig70-R16 | 1.86 | 2.01 | 35969 | 14387.6 | 1038 | 3.9 | 46.1
|
- The sequences for each primer is listed in the following table:
| Primer | Sequence |
|
| sig70-F1 | GCGCGCTCGAGAATAATTCTTAAAATTTATGCTTCCGGCTCG
|
| sig70-F2 | GCGCGCTCGAGAATAATTCTTAATATTTATGCTTCCGGCTCG
|
| sig70-F3 | GCGCGCTCGAGAATAATTCTTAAGATTTATGCTTCCGGCTCG
|
| sig70-F4 | GCGCGCTCGAGAATAATTCTTAACATTTATGCTTCCGGCTCG
|
| sig70-F5 | GCGCGCTCGAGAATAATTCTTTAAATTTATGCTTCCGGCTCG
|
| sig70-F6 | GCGCGCTCGAGAATAATTCTTTATATTTATGCTTCCGGCTCG
|
| sig70-F7 | GCGCGCTCGAGAATAATTCTTTAGATTTATGCTTCCGGCTCG
|
| sig70-F8 | GCGCGCTCGAGAATAATTCTTTACATTTATGCTTCCGGCTCG
|
| sig70-F9 | GCGCGCTCGAGAATAATTCTTGAAATTTATGCTTCCGGCTCG
|
| sig70-F10 | GCGCGCTCGAGAATAATTCTTGATATTTATGCTTCCGGCTCG
|
| sig70-F11 | GCGCGCTCGAGAATAATTCTTGAGATTTATGCTTCCGGCTCG
|
| sig70-F12 | GCGCGCTCGAGAATAATTCTTGACATTTATGCTTCCGGCTCG
|
| sig70-F13 | GCGCGCTCGAGAATAATTCTTCAAATTTATGCTTCCGGCTCG
|
| sig70-F14 | GCGCGCTCGAGAATAATTCTTCATATTTATGCTTCCGGCTCG
|
| sig70-F15 | GCGCGCTCGAGAATAATTCTTCAGATTTATGCTTCCGGCTCG
|
| sig70-F16 | GCGCGCTCGAGAATAATTCTTCACATTTATGCTTCCGGCTCG
|
| sig70-R1 | GCGGGATCCAATTGCACGTAAAATACGAGCCGGAAGCATAAA
|
| sig70-R2 | GCGGGATCCAATTGCACGTAATATACGAGCCGGAAGCATAAA
|
| sig70-R3 | GCGGGATCCAATTGCACGTAACATACGAGCCGGAAGCATAAA
|
| sig70-R4 | GCGGGATCCAATTGCACGTAAGATACGAGCCGGAAGCATAAA
|
| sig70-R5 | GCGGGATCCAATTGCACGTATAATACGAGCCGGAAGCATAAA
|
| sig70-R6 | GCGGGATCCAATTGCACGTATTATACGAGCCGGAAGCATAAA
|
| sig70-R7 | GCGGGATCCAATTGCACGTATGATACGAGCCGGAAGCATAAA
|
| sig70-R8 | GCGGGATCCAATTGCACGTATCATACGAGCCGGAAGCATAAA
|
| sig70-R9 | GCGGGATCCAATTGCACGTAGAATACGAGCCGGAAGCATAAA
|
| sig70-R10 | GCGGGATCCAATTGCACGTAGTATACGAGCCGGAAGCATAAA
|
| sig70-R11 | GCGGGATCCAATTGCACGTAGGATACGAGCCGGAAGCATAAA
|
| sig70-R12 | GCGGGATCCAATTGCACGTAGCATACGAGCCGGAAGCATAAA
|
| sig70-R13 | GCGGGATCCAATTGCACGTACAATACGAGCCGGAAGCATAAA
|
| sig70-R14 | GCGGGATCCAATTGCACGTACTATACGAGCCGGAAGCATAAA
|
| sig70-R15 | GCGGGATCCAATTGCACGTACGATACGAGCCGGAAGCATAAA
|
| sig70-R16 | GCGGGATCCAATTGCACGTACCATACGAGCCGGAAGCATAAA
|
- Stock dATP, dGTP, dCTP, dTTP from Invitrogen was diluted from 100mM to 0.5mM.
- See how the primer extension PCR is done in the protocol page.
- Both the varying promoters and the vector, pCS26, was digested using enzymes, XhoI and BamHI overnight. The vector was incubated at 37oC and the promoter was digested for 2 hours at 16oC and then overnight at room temperature (~21oC).
|
|
|
CHINMOYEE
Content / ideas on Modelling
Looked into papers to find Rate Constants . Unfortunately this endeavor was unsucessful .
After the meeting with Thane , me and vicky planned out the distribution of gene characteristics .
From the meeting with Vicky we both decided to think about some of the content / ideas we discussed for modeling .
I am going to be looking at curve fitting with the hill function and Static performance of the system .
|
|
|
EMILY
Verification NotI Digest
- Today I started with a NotI digest to verify the presence of the B0015 terminator in the J13002-LuxOD47E construct. I ran this on a gel and got good results. See gel photo below.
- Analysis: Lane 1 is J13002-LuxOD47E-B0015 trial 1, colony1, digested with Not1
Lane 2 is J13002-LuxOD47E-B0015 trial 1, colony 1, uncut
Lane 3 is colony 2 digested with NotI
Lane 4 is Colony 2, uncut
Lane 5 is colony 3 digested
Lane 6 is colony 3, uncut
Lane 7 is colony 4, digested
Lane 8 is colony 4, uncut
Lane 9 is J13002-LuxOD47E
Lane 10 is BBK LuxOD47E
- The digest looks like it worked as we see bands at around 3000 bp and 1500 bp in the digested lanes, representing the vector and the J13002-LuxOD47E-B0015 construct respectively. We are going to send colony 3 for sequencing as it has the least amount of random bands in it.
- Today I also helped Mandy with some formatting of the Wiki. We added a template for our header and added it to the other pages. We also edited the team members pictures and added some text descriptions to the Home page and Team pages. We also looked into using icons on the top of each page.
- Tomorrow I am going to send colony 3 down for sequencing in the morning.
|
|
|
FAHD
Marketing for July 16th 2009
Today, I concentrated my energies at marketing our iGEM project. Here is what I did today:
1) Call VWR, he offered to gives us free lab equipment and discounts on expensive lab equipment. He told me to e-mail him a list which thane said that he will prepare tomorrow.
2) Called Charles Rivers Lab and e-maile him a proposal and will follow up next week
3) Called Boheringer Ingleheim Canada and left her a voicemail
4) Called COTI and left him a voicemail
5) Called Bracco/ E-Z-EM canada and left him a voicemail
6) Called Life-Teac/Applied Biosystems and left her a voicemail
7) Called EMD Chemicals and e-mailed hera sponsorship package. Will folllow-up next week
8) Called Genome Canada and left him a voicemail
9) Called Nexen Inc. and left her a voicemail
10) E-mailed proposals Albian Sands Energy and Bietz Resources Ltd.
11) E-mailed proposals to Lonza Canada Inc., Quidel Corporation and Electron Microscopy Services. Since I did not have specific contacts, i e-mailed the proposals to their generic e-mail addresses and will follow up next week
12) Did my blog of the week for the marketing team
13) Went through the Micheal Smith awards application(NSERC) and will tell everybody abt it tomorrow in class
14) E-mailed a Thank You Card to Mr and Mrs Kubik
|
|
|
IMAN
Descriptive Title of What You're Doing
|
|
|
JAMIE
Descriptive Title of What You're Doing
|
|
|
JEREMY
Descriptive Title of What You're Doing
|
|
|
KATIE
Movement and Modification
The gel electrophoresis script has been modified and now it should be simple for Mandy to add any conditionals she would like to suit the lab activities. Also, the tube for bacteria transformation now has another tube beside it and every time a question for the quiz is answered, the tube will fill up a little more and once it reaches the top it will reset for another person to take the quiz. I would like to change the colours each time a question is answered depending on whether it was answered correctly or not, but for now it fills up using a green colour.
The water bath script is now being modified and I am inserting movement scripts using llSetPos() function into the donor and recipient tubes for restriction digest (due to my horrible attentiveness to saving, I lost this once today when second life froze my laptop – luckily the script is not too long). It is all under comments for now in the recipient tube and the donor tube is undergoing testing with the current script. The water bath listen script has been set up and the top will open using the touch_start event at the moment, which I will transfer to listen so that when the test tube begins to move over to it the top will open.
Once again the restriction digest tubes cannot be used the way they were intended while I add the movement code to the existing script so this activity will probably be under construction until early next week. I will still need to determine the proper placement for the tubes as they move so they do not go through the walls of the water bath, actually end up in the water and do not end up in the exact same place to appear as one tube.
Tomorrow I would like to:
- Finish up the listen/response scripts that I started for the heating block and phosphatase treatment that were adapted from the water bath.
- Get the movement of the tubes for restriction digest moving smoothly and to the proper positions within the lab. If I am able to complete this I believe I will clean up a couple of my scripts so that they look presentable for the video I have to do for the blog next Tuesday.
- If I am able to get restriction digest functioning again, I would like to return to working on the sequencer, which I have neglected this week. I will need to test the note card reading script to make sure it is functioning the way I would like it to and then I will add it to the sequencer.
|
|
|
KEVIN
1. Plasmid Isolation
Pqrr4+I13500 plasmids were isolated from yesterday's overnight culture by using Sigma's GenElute miniprep kit. (sigma) Then the product's purity and concentration was measured with nanodrop utility. The isolated plasmid was pure enough to move on.
2. Restriction Digest
To verify the presence of Pqrr4+I13500, I performed restriction digest on the above plasmid using XbaI and PstI enzymes. The following is a picture of the gel:
Every lane worked except 9. It seems like non specific cutting happend in lane of colony 9. It can be sequenced now to verify for sure that it is in there.
3. Overnight culture of B0034
Overnights of B0034 were grown for tomorrow's Plasmid Isolation and Construction.
|
|
|
MANDY
Descriptive Title of What You're Doing
|
|
|
PATRICK
Descriptive Title of What You're Doing
|
|
|
PRIMA
Descriptive Title of What You're Doing
|
|
|
STEFAN
More ethics
So ethics meeting will be coming up shortly so I'm doing a lot of
reading. Second Life will pick up again this weekend.
Today I read:
Henkel, J. and Maurer, SM., 2007, The Economics of Synthetic Biology,
Molecular Systems Biology 3 (117):1-4.
This paper deals a lot with the economical repercussions of having
standard biological parts for synthetic biology and raises several
important issues. Since standardized components are a fundamental part
of iGEM, this paper will help us look deeper into the pros and cons of
an open source system. Detailed notes were taken to later implemented into the paper.
|
|
|
VICKI
Descriptive Title of What You're Doing
|
"
