Team:Calgary/28 May 2009

• Continued with reading up on things to characterize for the AI-2 system
• Started familiarization with Single Site-Directed Mutagenesis protocol
• Primers for mutagenesis is ordered. The following are the sequences for the mutagenesis:

LuxCDABE-M-F:CCATTAATGAATTGCCGGATAATCTGGATTTTGAAGGCC
LuxCDABE-M-R:GGCCTTCAAAATCCAGATTATCCGGCAATTCATTAATGG

• Both primers are PAGE purified.
• Received licences for Matlab and Simbiology. Downloaded program and was able to practice through examples found in the Matlab package. Focused on G protein cascase model (example in Matlab) in Yeast and prepared a presentation to show other iGEM members how Simbiology works.

• Objective: To veriffy the presence of the LuxOD47E gene in the psB1AC3 BBK vector

Size of plasmid Backbone: 3055 bp
Size of the gene of interest: 1362 bp
Total size: 4417 bp

Sequencing needs 100ng of DNA/ 1 kb
4.4kb x 100ng/kb = 440ng
Concentration of C2= 92.9ng/μL
440ng/ 92.9 ng/uL = 4.8 μL DNA

Diluted 4.8 μL DNA (LuxOD47E BBK C2) with 5.2 μL ddH20 and sent down to Univeristy of Calgary Sequencing Labs with VF2 and VF1 primers.

• Results: Sequencing came back and results indicated that the gene if interest, LuxOD47E was not in the psB1AC3 vector. We will have to go back to the gene in the pCR2.1-TOPO vector and try to get it into the psB1AC3 vector.

File:2009.05.28.D47E BBkVer RD+PCR.tif

No experiments were done on this day.