"
Team:KULeuven/Notebook/Blue Light Receptor
From 2009.igem.org
(Difference between revisions)
JochemDeen (Talk | contribs) |
JochemDeen (Talk | contribs) |
||
| Line 15: | Line 15: | ||
==15 July== | ==15 July== | ||
*Mail Institut fur Mikrobiologie der Westfalischen, Wilhelms-Universitat Munster for the plasmid [Done] | *Mail Institut fur Mikrobiologie der Westfalischen, Wilhelms-Universitat Munster for the plasmid [Done] | ||
| + | |||
| + | ==23 July== | ||
| + | * Primers for the blue light receptor have arrived | ||
| + | |||
| + | ==24 July== | ||
| + | * PCR on primers and tested on agarose gel | ||
Revision as of 13:14, 24 July 2009
Contents |
13 July
- YCGF Gene, natural available in 3 E. Coli strains. Can use the promotor of Ycgf gene for expression
- Probable strain K12
- Promotor voor YCGF gene:
- AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG (bron: [www.ncbi.nlm.nih.gov])
14 July
- Primer selection for the promotor [Done]
- Send mail to Institut for Biologie-Mikrobiologie (The BLUF-EAL protein YcgF acts as a direct anti-repressor in a blue-light response of Escherichia coli) [Done]
15 July
- Mail Institut fur Mikrobiologie der Westfalischen, Wilhelms-Universitat Munster for the plasmid [Done]
23 July
- Primers for the blue light receptor have arrived
24 July
- PCR on primers and tested on agarose gel
