Team:Paris/Freezer Primers
From 2009.igem.org
(Difference between revisions)
(New page: {{Template:Paris2009}} {{Template:Paris2009_menu}} ==Freezer== <center> Primers - PCR products - [[Team:Paris/Fr...) |
Christophe.R (Talk | contribs) |
||
(50 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
+ | <span/ id="bottom">[https://2009.igem.org/ iGEM ] > [[Team:Paris#top | Paris]] > [[Team:Paris/Freezer#top | Freezer]] > [[Team:Paris/Freezer_Primers#bottom | Primers]] | ||
{{Template:Paris2009}} | {{Template:Paris2009}} | ||
{{Template:Paris2009_menu}} | {{Template:Paris2009_menu}} | ||
Line 5: | Line 6: | ||
<center> | <center> | ||
- | [[Team:Paris/Freezer_Primers | Primers]] - | + | [[Team:Paris/Freezer_Primers#Freezer | Primers]] - |
- | [[Team:Paris/Freezer_PCR_products | PCR products]] - | + | [[Team:Paris/Freezer_PCR_products#Freezer | PCR products]] - |
- | [[Team:Paris/Freezer_Plasmids | Plasmids]] - | + | [[Team:Paris/Freezer_Plasmids#Freezer | Plasmids]] - |
- | [[Team:Paris/Freezer_Digestion_Products | Digestion Products]] - | + | [[Team:Paris/Freezer_Digestion_Products#Freezer | Digestion Products]] - |
- | [[Team:Paris/Freezer_Unexpected_digestion_results | Unexpected digestion results]] - | + | [[Team:Paris/Freezer_Unexpected_digestion_results#Freezer | Unexpected digestion results]] - |
- | [[Team:Paris/Freezer_Strains_(Glycerol stock) | Strains (Glycerol stock)]] | + | [[Team:Paris/Freezer_Strains_(Glycerol stock)#Freezer | Strains (Glycerol stock)]] - [[Team:Paris/constructions#Freezer | Construction in progress]] |
</center> | </center> | ||
- | |||
{| | {| | ||
|- style="background: #c5c5c5;" | |- style="background: #c5c5c5;" | ||
Line 35: | Line 35: | ||
== Primers == | == Primers == | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O1] Rev P1 | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O1"> [O1] Rev P1 |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
|width=700px| tolR | |width=700px| tolR | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | + | |style="background:#0d3e99; color:white; text-align: right;" |Sequence (5' > 3') |
|TCTGCTGCAGCGGCCGCTACTAGTATTAGTAAGGCACATCTTTTGCGCCACCG | |TCTGCTGCAGCGGCCGCTACTAGTATTAGTAAGGCACATCTTTTGCGCCACCG | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | |style="background:#0d3e99; color:white; text-align: right;"|Designer | + | |style="background:#0d3e99; color:white; text-align: right;" |Designer |
|D. Bikard | |D. Bikard | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O2] Fwd P2 | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O2"> [O2] Fwd P2 (ERROR : Do not use) |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| tolR | + | |width=700px| tolR |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 62: | Line 63: | ||
|D. Bikard | |D. Bikard | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O3] Rev P3 | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O3"> [O3] Rev P3 |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 78: | Line 80: | ||
|D. Bikard | |D. Bikard | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O4] Rev P4 | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O4"> [O4] Rev P4 (ERROR: Not designed for N-term fusion) |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| tolA | + | |width=700px| tolA |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 94: | Line 97: | ||
|D. Bikard | |D. Bikard | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O5] Rev P5 | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O5"> [O5] Rev P5 |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 110: | Line 114: | ||
|D. Bikard | |D. Bikard | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [06] Fwd P6 | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O6"> [06] Fwd P6 (ERROR: without RBS) |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| tatABC | + | |width=700px| tatABC |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 126: | Line 131: | ||
|D. Bikard | |D. Bikard | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27]) | ||
|} | |} | ||
- | |||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O7] Rev P7 | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O7"> [O7] Rev P7 (ERROR: not the good standard for fusion) |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 143: | Line 148: | ||
|D. Bikard | |D. Bikard | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27]) | ||
|} | |} | ||
- | |||
- | |||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O8] Fwd P8 | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O8"> [O8] Fwd P8 (ERROR: No poly-Gly linker) |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| clyA fusion | + | |width=700px| clyA fusion |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 161: | Line 165: | ||
|D. Bikard | |D. Bikard | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O9] clyA_Rw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O9"> [O9] clyA_Rw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| clyA | + | |width=700px| clyA (for N term fusion) |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 177: | Line 182: | ||
|G. Cambray | |G. Cambray | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: no | ||
|} | |} | ||
Line 183: | Line 189: | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O10] clyA_fusion_polyG_Rw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O10"> [O10] clyA_fusion_polyG_Rw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 194: | Line 200: | ||
|G. Cambray | |G. Cambray | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
Line 200: | Line 208: | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O11] ompA_signal_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O11"> [O11] ompA_signal_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 211: | Line 219: | ||
|G. Cambray | |G. Cambray | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
Line 217: | Line 227: | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O12] ompA_signal_fusion_Rw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O12"> [O12] ompA_signal_fusion_Rw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 228: | Line 238: | ||
|G. Cambray | |G. Cambray | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O13] tolR_II_Fusion_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O13"> [O13] tolR_II_Fusion_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 244: | Line 256: | ||
|G. Cambray | |G. Cambray | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
- | |||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O14] tatABC_RBS_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O14"> [O14] tatABC_RBS_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 260: | Line 273: | ||
|G. Cambray | |G. Cambray | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O15] TE3_fusion_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O15"> [O15] TE3_fusion_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 274: | Line 289: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |C.Loy |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O16] TE3_Rw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O16"> [O16] TE3_Rw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 290: | Line 307: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |C.Loy |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
Line 298: | Line 317: | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O17] Tg3p_Rw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O17"> [O17] Tg3p_Rw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 307: | Line 326: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |C. Loy |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O18] Tg3p_fusion_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O18"> [O18] Tg3p_fusion_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 323: | Line 344: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |C.Loy |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O19] g3p_F | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O19"> [O19] g3p_F |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 339: | Line 362: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | |G. | + | |G. Beauclair |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O20] g3p_R | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O20"> [O20] g3p_R |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 355: | Line 379: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | |G. | + | |G. Beauclair |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
- | |||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O21] Ompa_linker_F | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O21"> [O21] Ompa_linker_F |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 371: | Line 395: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | |G. | + | |G. Beauclair |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O22] Ompa_linker_R | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O22"> [O22] Ompa_linker_R |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
Line 387: | Line 412: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | |G. | + | |G. Beauclair |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O23] OmpAsignal-TE3_seq_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O23"> [O23] OmpAsignal-TE3_seq_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| | + | |width=700px| For sequencing of part OmpAsignal-TE3 |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 403: | Line 429: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |C.Loy |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O24] OmpAsignal-TE3_seq_Rw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O24"> [O24] OmpAsignal-TE3_seq_Rw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| | + | |width=700px| For sequencing of part OmpAsignal-TE3 |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 419: | Line 446: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |C.Loy |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O25] VAMP2_Seq_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O25"> [O25] VAMP2_Seq_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| | + | |width=700px| For sequencing of VAMP2 (snare) |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 435: | Line 463: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |S.Boumahdi |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O26] VAMP2_Seq_Rv | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O26"> [O26] VAMP2_Seq_Rv |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| | + | |width=700px| For sequencing of VAMP2 (snare) |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 451: | Line 480: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |S.Boumahdi |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O27] ClyA_seq_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O27"> [O27] ClyA_seq_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| | + | |width=700px| For sequencing of clyA after amplification |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 467: | Line 497: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |V.Du |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O28] ClyA_seq_Rw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O28"> [O28] ClyA_seq_Rw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| | + | |width=700px| For sequencing of clyA after amplification |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 483: | Line 514: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |V.Du |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O29] PFecA_Fw | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O29"> [O29] PFecA_Fw |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| | + | |width=700px| For signal transduction |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
Line 499: | Line 531: | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
- | | | + | |R.Bodinier |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
|} | |} | ||
{| | {| | ||
- | ! colspan="6" style="background: #c5c5c5;" | [O30] PFecA_Rv | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O30"> [O30] PFecA_Rv |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
- | |width=700px| | + | |width=700px| For signal transduction |
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
|GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTTTGTTGTGTTCAGCTATGAGT | |GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTTTGTTGTGTTCAGCTATGAGT | ||
+ | |- style="background: #cbcee0;" | ||
+ | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
+ | |R.Bodinier | ||
+ | |- style="background: #cbcee0;" | ||
+ | |style="background: #0d3e99; color:white; text-align: right;" | Status | ||
+ | | style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no | ||
+ | |} | ||
+ | |||
+ | |||
+ | {| | ||
+ | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O31"> [O31] clyA_RBS_Fw | ||
+ | |- style="background: #cbcee0;" | ||
+ | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | ||
+ | |width=700px| amplify clyA with RBS in the primer (std 10) | ||
+ | |- style="background: #cbcee0;" | ||
+ | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
+ | |TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGACTGAAATCGTTGCAGATAAAAC | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
|style="background:#0d3e99; color:white; text-align: right;"|Designer | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
|G. Cambray | |G. Cambray | ||
|- style="background: #cbcee0;" | |- style="background: #cbcee0;" | ||
- | + | |style="background: #0d3e99; color:white; text-align: right;" | Status | |
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes | ||
+ | ([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05]) | ||
|} | |} | ||
- | + | {| | |
- | </ | + | ! colspan="6" style="background: #c5c5c5;" | <span/ id="O32"> [O32] clyA fusion_polyG_Fw |
- | + | |- style="background: #cbcee0;" | |
- | + | |style="background:#0d3e99; color:white; text-align: right;" width=120px|Description | |
- | + | |width=700px| clyA fusion Fw (with 5-Gly linker) | |
- | + | |- style="background: #cbcee0;" | |
+ | |style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3') | ||
+ | |GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGCGGCGGCGGCGGCACTGAAATCGTTGCAGATAAAAC | ||
+ | |- style="background: #cbcee0;" | ||
+ | |style="background:#0d3e99; color:white; text-align: right;"|Designer | ||
+ | |G. Cambray | ||
+ | |- style="background: #cbcee0;" | ||
+ | |style="background: #0d3e99; color:white; text-align: right;" | Status | ||
+ | | style="font-weight:bold;" |Ordered: 07/27 ; Received: no ; Used in wet lab: no | ||
+ | ( ) | ||
+ | |} |
Latest revision as of 13:42, 28 August 2009
iGEM > Paris > Freezer > Primers
Freezer
Primers - PCR products - Plasmids - Digestion Products - Unexpected digestion results - Strains (Glycerol stock) - Construction in progress
Color code for sticker | |||||||
---|---|---|---|---|---|---|---|
Vector | Insert | PCR product | Plasmid | Strains | Kanamycin | Ampicilin | Chloranphenicol |
Primers
[O1] Rev P1 | |||||
---|---|---|---|---|---|
Description | tolR | ||||
Sequence (5' > 3') | TCTGCTGCAGCGGCCGCTACTAGTATTAGTAAGGCACATCTTTTGCGCCACCG | ||||
Designer | D. Bikard | ||||
Status | Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27) |
[O2] Fwd P2 (ERROR : Do not use) | |||||
---|---|---|---|---|---|
Description | tolR | ||||
Sequence (5' > 3') | TCTGGAATTCGCGGCCGCTTCTAGATGAAATCAACATTGTACCGTTGCTGGACGTACTG | ||||
Designer | D. Bikard | ||||
Status | Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27) |
[O3] Rev P3 | |||||
---|---|---|---|---|---|
Description | tolA | ||||
Sequence (5' > 3') | TCTGCTGCAGCGGCCGCTACTAGTATTATTACGGTTTGAAGTCCAATGGCG | ||||
Designer | D. Bikard | ||||
Status | Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27) |
[O4] Rev P4 (ERROR: Not designed for N-term fusion) | |||||
---|---|---|---|---|---|
Description | tolA | ||||
Sequence (5' > 3') | TCTGGAATTCGCGGCCGCTTCTAGAATGGGTAATACTAAAAACAATGGCGC | ||||
Designer | D. Bikard | ||||
Status | Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27) |
[O5] Rev P5 | |||||
---|---|---|---|---|---|
Description | tatABC | ||||
Sequence (5' > 3') | TCTGCTGCAGCGGCCGCTACTAGTATTATTATTCTTCAGTTTTTTCGCTTTCTGC | ||||
Designer | D. Bikard | ||||
Status | Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27) |
[06] Fwd P6 (ERROR: without RBS) | |||||
---|---|---|---|---|---|
Description | tatABC | ||||
Sequence (5' > 3') | TCTGGAATTCGCGGCCGCTTCTAGAATGGGTGGTATCAGTATTTGG | ||||
Designer | D. Bikard | ||||
Status | Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27) |
[O7] Rev P7 (ERROR: not the good standard for fusion) | |||||
---|---|---|---|---|---|
Description | clyA fusion | ||||
Sequence (5' > 3') | TTTCTGCAGCGGCCGCTACTAGTGACTTCAGGTACCTCAAAGAGTGTC | ||||
Designer | D. Bikard | ||||
Status | Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27) |
[O8] Fwd P8 (ERROR: No poly-Gly linker) | |||||
---|---|---|---|---|---|
Description | clyA fusion | ||||
Sequence (5' > 3') | TTTGAATTCGCGGCCGCTTCTAGAATGACTGAAATCGTTGCAGATAAAA | ||||
Designer | D. Bikard | ||||
Status | Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27) |
[O9] clyA_Rw | |||||
---|---|---|---|---|---|
Description | clyA (for N term fusion) | ||||
Sequence (5' > 3') | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGACTTCAGGTACCTCAAAGAG | ||||
Designer | G. Cambray | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: no |
[O10] clyA_fusion_polyG_Rw | |||||
---|---|---|---|---|---|
Description | clyA fusion (with 5-Gly linker) | ||||
Sequence (5' > 3') | GTTTCTTCCTGCAGCGGCCGCTACTAGTGCCGCCGCCGCCGCCGACTTCAGGTACCTCAAAGAG | ||||
Designer | G. Cambray | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O11] ompA_signal_Fw | |||||
---|---|---|---|---|---|
Description | ompA signal for export to periplasm - from expression vector RBS as in pIN-III-ompA-2 vector - keeps vector original RBS | ||||
Sequence (5' > 3') | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAACGAGGGCAAAAAATGAAAAAG | ||||
Designer | G. Cambray | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O12] ompA_signal_fusion_Rw | |||||
---|---|---|---|---|---|
Description | ompA signal for export to periplasm - from expression vector pIN-III-ompA-2 - original RBS from the vector | ||||
Sequence (5' > 3') | GTTTCTTCCTGCAGCGGCCGCTACTAGTGGCCTGCGCTACGGTAGCGAAAC | ||||
Designer | G. Cambray | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O13] tolR_II_Fusion_Fw | |||||
---|---|---|---|---|---|
Description | For fusion of tolR domain II (standard 23) | ||||
Sequence (5' > 3') | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGGTCGATCTGCCAGACGCTAC | ||||
Designer | G. Cambray | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O14] tatABC_RBS_Fw | |||||
---|---|---|---|---|---|
Description | Amplification from tatA - contains RBS | ||||
Sequence (5' > 3') | TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGATGGGTGGTATCAGTATTTGG | ||||
Designer | G. Cambray | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O15] TE3_fusion_Fw | |||||
---|---|---|---|---|---|
Description | Fusion of N-term domain of colicin E3 (standard 23) | ||||
Sequence (5' > 3') | GTTTCTTCGAATTCGCGGCCGCTTCTAGAAGCGGTGGCGATGGACGCGGCCATAAC | ||||
Designer | C.Loy | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O16] TE3_Rw | |||||
---|---|---|---|---|---|
Description | Amplification of N-term domain of colicin E3 (standard 23) | ||||
Sequence (5' > 3') | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGCGTTCATAATTTCGCTCAG | ||||
Designer | C.Loy | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O17] Tg3p_Rw | |||||
---|---|---|---|---|---|
Description | Amplification of N-term domain of M13's g3p | ||||
Sequence (5' > 3') | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAACACTGAGTTTCGTCACCAGTAC | ||||
Designer | C. Loy | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O18] Tg3p_fusion_Fw | |||||
---|---|---|---|---|---|
Description | Fusion of N-term domain of M13's g3p (standard 23) | ||||
Sequence (5' > 3') | GTTTCTTCGAATTCGCGGCCGCTTCTAGAAAAAAATTATTATTCGCAATTCCTTTAG | ||||
Designer | C.Loy | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O19] g3p_F | |||||
---|---|---|---|---|---|
Description | g3p | ||||
Sequence (5' > 3') | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCTCCGCTGAAACTGTTGAAAGTTG | ||||
Designer | G. Beauclair | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O20] g3p_R | |||||
---|---|---|---|---|---|
Description | g3p | ||||
Sequence (5' > 3') | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAAGACTCCTTATTACGCAG | ||||
Designer | G. Beauclair | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O21] Ompa_linker_F | |||||
---|---|---|---|---|---|
Description | For standardisation of OmpA linker (BBaK103006) | ||||
Sequence (5' > 3') | TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGAAAGCTACTAAACTGGTACTGG | ||||
Designer | G. Beauclair | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O22] Ompa_linker_R | |||||
---|---|---|---|---|---|
Description | For standardisation of OmpA linker (BBaK103006) | ||||
Sequence (5' > 3') | GTTTCTTCCTGCAGCGGCCGCTACTAGTAGAGCTCCCTCCTCCAGAACC | ||||
Designer | G. Beauclair | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O23] OmpAsignal-TE3_seq_Fw | |||||
---|---|---|---|---|---|
Description | For sequencing of part OmpAsignal-TE3 | ||||
Sequence (5' > 3') | CACAAATAGCGAAAGATGAC | ||||
Designer | C.Loy | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O24] OmpAsignal-TE3_seq_Rw | |||||
---|---|---|---|---|---|
Description | For sequencing of part OmpAsignal-TE3 | ||||
Sequence (5' > 3') | ATCATCTGCGGGTAATGATG | ||||
Designer | C.Loy | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O25] VAMP2_Seq_Fw | |||||
---|---|---|---|---|---|
Description | For sequencing of VAMP2 (snare) | ||||
Sequence (5' > 3') | ACTCACTATAGGGAGACCACA | ||||
Designer | S.Boumahdi | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O26] VAMP2_Seq_Rv | |||||
---|---|---|---|---|---|
Description | For sequencing of VAMP2 (snare) | ||||
Sequence (5' > 3') | GGGCTTTGTTAGCAGCCGGAT | ||||
Designer | S.Boumahdi | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O27] ClyA_seq_Fw | |||||
---|---|---|---|---|---|
Description | For sequencing of clyA after amplification | ||||
Sequence (5' > 3') | GCAGCTATTTCCAGTCACAG | ||||
Designer | V.Du | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O28] ClyA_seq_Rw | |||||
---|---|---|---|---|---|
Description | For sequencing of clyA after amplification | ||||
Sequence (5' > 3') | CGCCCGCAGCAATAGAATAG | ||||
Designer | V.Du | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O29] PFecA_Fw | |||||
---|---|---|---|---|---|
Description | For signal transduction | ||||
Sequence (5' > 3') | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTACGCGGTACTGGATAAACATTTC | ||||
Designer | R.Bodinier | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O30] PFecA_Rv | |||||
---|---|---|---|---|---|
Description | For signal transduction | ||||
Sequence (5' > 3') | GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTTTGTTGTGTTCAGCTATGAGT | ||||
Designer | R.Bodinier | ||||
Status | Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no |
[O31] clyA_RBS_Fw | |||||
---|---|---|---|---|---|
Description | amplify clyA with RBS in the primer (std 10) | ||||
Sequence (5' > 3') | TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGACTGAAATCGTTGCAGATAAAAC | ||||
Designer | G. Cambray | ||||
Status | Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
(08/05) |
[O32] clyA fusion_polyG_Fw | |||||
---|---|---|---|---|---|
Description | clyA fusion Fw (with 5-Gly linker) | ||||
Sequence (5' > 3') | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGCGGCGGCGGCGGCACTGAAATCGTTGCAGATAAAAC | ||||
Designer | G. Cambray | ||||
Status | Ordered: 07/27 ; Received: no ; Used in wet lab: no
( ) |