Team:Paris/Freezer Primers

From 2009.igem.org

(Difference between revisions)
(→Primers)
 
(38 intermediate revisions not shown)
Line 1: Line 1:
 +
<span/ id="bottom">[https://2009.igem.org/ iGEM ] > [[Team:Paris#top | Paris]] > [[Team:Paris/Freezer#top | Freezer]] > [[Team:Paris/Freezer_Primers#bottom | Primers]]
{{Template:Paris2009}}
{{Template:Paris2009}}
{{Template:Paris2009_menu}}
{{Template:Paris2009_menu}}
Line 10: Line 11:
[[Team:Paris/Freezer_Digestion_Products#Freezer | Digestion Products]] -  
[[Team:Paris/Freezer_Digestion_Products#Freezer | Digestion Products]] -  
[[Team:Paris/Freezer_Unexpected_digestion_results#Freezer | Unexpected digestion results]] -  
[[Team:Paris/Freezer_Unexpected_digestion_results#Freezer | Unexpected digestion results]] -  
-
[[Team:Paris/Freezer_Strains_(Glycerol stock)#Freezer | Strains (Glycerol stock)]]
+
[[Team:Paris/Freezer_Strains_(Glycerol stock)#Freezer | Strains (Glycerol stock)]] - [[Team:Paris/constructions#Freezer | Construction in progress]]
</center>
</center>
-
<br>
 
{|
{|
|- style="background: #c5c5c5;"
|- style="background: #c5c5c5;"
Line 35: Line 35:
== Primers ==
== Primers ==
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O1] Rev P1
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O1"> [O1] Rev P1
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
| tolR
+
|width=700px| tolR
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
+
|style="background:#0d3e99; color:white; text-align: right;" |Sequence (5' > 3')
|TCTGCTGCAGCGGCCGCTACTAGTATTAGTAAGGCACATCTTTTGCGCCACCG
|TCTGCTGCAGCGGCCGCTACTAGTATTAGTAAGGCACATCTTTTGCGCCACCG
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
|style="background:#0d3e99; color:white; text-align: right;"|Designer
+
|style="background:#0d3e99; color:white; text-align: right;" |Designer
|D. Bikard
|D. Bikard
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Status
+
|style="background: #0d3e99; color:white; text-align: right;" | Status
-
|width=240px|Ordered: --/--
+
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
-
|width=230px| received: --/-- 
+
-
|width=230px|worked: yes
+
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O2] Fwd P2
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O2"> [O2] Fwd P2 (ERROR : Do not use)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| tolR (DO NOT USE ERROR)
+
|width=700px| tolR
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 65: Line 63:
|D. Bikard
|D. Bikard
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O3] Rev P3
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O3"> [O3] Rev P3
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 81: Line 80:
|D. Bikard
|D. Bikard
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O4] Rev P4
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O4"> [O4] Rev P4 (ERROR: Not designed for N-term fusion)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| tolA (ERROR: Not designed for N-term fusion)
+
|width=700px| tolA  
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 97: Line 97:
|D. Bikard
|D. Bikard
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O5] Rev P5
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O5"> [O5] Rev P5
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 113: Line 114:
|D. Bikard
|D. Bikard
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [06] Fwd P6
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O6"> [06] Fwd P6 (ERROR: without RBS)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| tatABC (without RBS)
+
|width=700px| tatABC  
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 129: Line 131:
|D. Bikard
|D. Bikard
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
-
 
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O7] Rev P7
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O7"> [O7] Rev P7 (ERROR: not the good standard for fusion)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 146: Line 148:
|D. Bikard
|D. Bikard
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
-
 
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O8] Fwd P8
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O8"> [O8] Fwd P8 (ERROR: No poly-Gly linker)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| clyA fusion (ERROR: No poly-Gly linker)
+
|width=700px| clyA fusion  
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 163: Line 165:
|D. Bikard
|D. Bikard
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Worked
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O9] clyA_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O9"> [O9] clyA_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| clyA
+
|width=700px| clyA (for N term fusion)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 179: Line 182:
|G. Cambray
|G. Cambray
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: no
|}
|}
Line 185: Line 189:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O10] clyA_fusion_polyG_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O10"> [O10] clyA_fusion_polyG_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 196: Line 200:
|G. Cambray
|G. Cambray
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
Line 202: Line 208:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O11] ompA_signal_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O11"> [O11] ompA_signal_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 213: Line 219:
|G. Cambray
|G. Cambray
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
Line 219: Line 227:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O12] ompA_signal_fusion_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O12"> [O12] ompA_signal_fusion_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 230: Line 238:
|G. Cambray
|G. Cambray
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O13] tolR_II_Fusion_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O13"> [O13] tolR_II_Fusion_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 246: Line 256:
|G. Cambray
|G. Cambray
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
-
 
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O14] tatABC_RBS_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O14"> [O14] tatABC_RBS_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 262: Line 273:
|G. Cambray
|G. Cambray
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O15] TE3_fusion_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O15"> [O15] TE3_fusion_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 276: Line 289:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|C.Loy
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O16] TE3_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O16"> [O16] TE3_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 292: Line 307:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|C.Loy
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
Line 300: Line 317:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O17] Tg3p_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O17"> [O17] Tg3p_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 309: Line 326:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|C. Loy
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O18] Tg3p_fusion_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O18"> [O18] Tg3p_fusion_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 325: Line 344:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|C.Loy
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O19] g3p_F
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O19"> [O19] g3p_F
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 341: Line 362:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|G. Beauclair
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O20] g3p_R
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O20"> [O20] g3p_R
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 357: Line 379:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|G. Beauclair
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
-
 
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O21] Ompa_linker_F
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O21"> [O21] Ompa_linker_F
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 373: Line 395:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|G. Beauclair
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O22] Ompa_linker_R
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O22"> [O22] Ompa_linker_R
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 389: Line 412:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|G. Beauclair
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O23] OmpAsignal-TE3_seq_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O23"> [O23] OmpAsignal-TE3_seq_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| ???
+
|width=700px| For sequencing of part OmpAsignal-TE3
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 405: Line 429:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|C.Loy
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O24] OmpAsignal-TE3_seq_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O24"> [O24] OmpAsignal-TE3_seq_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| ???
+
|width=700px| For sequencing of part OmpAsignal-TE3
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 421: Line 446:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|C.Loy
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O25] VAMP2_Seq_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O25"> [O25] VAMP2_Seq_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| ???
+
|width=700px| For sequencing of VAMP2 (snare)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 437: Line 463:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|S.Boumahdi
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O26] VAMP2_Seq_Rv
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O26"> [O26] VAMP2_Seq_Rv
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| ???
+
|width=700px| For sequencing of VAMP2 (snare)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 453: Line 480:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|S.Boumahdi
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O27] ClyA_seq_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O27"> [O27] ClyA_seq_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| ???
+
|width=700px| For sequencing of clyA after amplification
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 469: Line 497:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|V.Du
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O28] ClyA_seq_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O28"> [O28] ClyA_seq_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| ???
+
|width=700px| For sequencing of clyA after amplification
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 485: Line 514:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|V.Du
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O29] PFecA_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O29"> [O29] PFecA_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| ???
+
|width=700px| For signal transduction
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 501: Line 531:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|R.Bodinier
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O30] PFecA_Rv
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O30"> [O30] PFecA_Rv
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
-
|width=700px| ???
+
|width=700px| For signal transduction
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
Line 517: Line 548:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;"|Designer
|style="background:#0d3e99; color:white; text-align: right;"|Designer
-
|G. Cambray
+
|R.Bodinier
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O31] clyA_RBS_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O31"> [O31] clyA_RBS_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 535: Line 567:
|G. Cambray
|G. Cambray
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
-
!colspan="6" style="background:#c5c5c5; text-align: right;" | Not Tested
+
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
 +
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
 +
|}
 +
 
 +
 
 +
{|
 +
! colspan="6" style="background: #c5c5c5;" | <span/ id="O32"> [O32] clyA fusion_polyG_Fw
 +
|- style="background: #cbcee0;"
 +
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
 +
|width=700px| clyA fusion Fw (with 5-Gly linker)
 +
|- style="background: #cbcee0;"
 +
|style="background:#0d3e99; color:white; text-align: right;"|Sequence (5' > 3')
 +
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGCGGCGGCGGCGGCACTGAAATCGTTGCAGATAAAAC
 +
|- style="background: #cbcee0;"
 +
|style="background:#0d3e99; color:white; text-align: right;"|Designer
 +
|G. Cambray
 +
|- style="background: #cbcee0;"
 +
|style="background: #0d3e99; color:white;  text-align: right;" | Status
 +
| style="font-weight:bold;" |Ordered: 07/27 ; Received: no ; Used in wet lab: no
 +
( )
|}
|}

Latest revision as of 13:42, 28 August 2009

iGEM > Paris > Freezer > Primers

Freezer

Primers - PCR products - Plasmids - Digestion Products - Unexpected digestion results - Strains (Glycerol stock) - Construction in progress

Color code for sticker
Vector Insert PCR product Plasmid Strains Kanamycin Ampicilin Chloranphenicol

Primers

[O1] Rev P1
Description tolR
Sequence (5' > 3') TCTGCTGCAGCGGCCGCTACTAGTATTAGTAAGGCACATCTTTTGCGCCACCG
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O2] Fwd P2 (ERROR : Do not use)
Description tolR
Sequence (5' > 3') TCTGGAATTCGCGGCCGCTTCTAGATGAAATCAACATTGTACCGTTGCTGGACGTACTG
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O3] Rev P3
Description tolA
Sequence (5' > 3') TCTGCTGCAGCGGCCGCTACTAGTATTATTACGGTTTGAAGTCCAATGGCG
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O4] Rev P4 (ERROR: Not designed for N-term fusion)
Description tolA
Sequence (5' > 3') TCTGGAATTCGCGGCCGCTTCTAGAATGGGTAATACTAAAAACAATGGCGC
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O5] Rev P5
Description tatABC
Sequence (5' > 3') TCTGCTGCAGCGGCCGCTACTAGTATTATTATTCTTCAGTTTTTTCGCTTTCTGC
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[06] Fwd P6 (ERROR: without RBS)
Description tatABC
Sequence (5' > 3') TCTGGAATTCGCGGCCGCTTCTAGAATGGGTGGTATCAGTATTTGG
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O7] Rev P7 (ERROR: not the good standard for fusion)
Description clyA fusion
Sequence (5' > 3') TTTCTGCAGCGGCCGCTACTAGTGACTTCAGGTACCTCAAAGAGTGTC
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O8] Fwd P8 (ERROR: No poly-Gly linker)
Description clyA fusion
Sequence (5' > 3') TTTGAATTCGCGGCCGCTTCTAGAATGACTGAAATCGTTGCAGATAAAA
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O9] clyA_Rw
Description clyA (for N term fusion)
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGACTTCAGGTACCTCAAAGAG
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: no


[O10] clyA_fusion_polyG_Rw
Description clyA fusion (with 5-Gly linker)
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTGCCGCCGCCGCCGCCGACTTCAGGTACCTCAAAGAG
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O11] ompA_signal_Fw
Description ompA signal for export to periplasm - from expression vector RBS as in pIN-III-ompA-2 vector - keeps vector original RBS
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAACGAGGGCAAAAAATGAAAAAG
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O12] ompA_signal_fusion_Rw
Description ompA signal for export to periplasm - from expression vector pIN-III-ompA-2 - original RBS from the vector
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTGGCCTGCGCTACGGTAGCGAAAC
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O13] tolR_II_Fusion_Fw
Description For fusion of tolR domain II (standard 23)
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGGTCGATCTGCCAGACGCTAC
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)

[O14] tatABC_RBS_Fw
Description Amplification from tatA - contains RBS
Sequence (5' > 3') TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGATGGGTGGTATCAGTATTTGG
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O15] TE3_fusion_Fw
Description Fusion of N-term domain of colicin E3 (standard 23)
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAAGCGGTGGCGATGGACGCGGCCATAAC
Designer C.Loy
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O16] TE3_Rw
Description Amplification of N-term domain of colicin E3 (standard 23)
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGCGTTCATAATTTCGCTCAG
Designer C.Loy
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O17] Tg3p_Rw
Description Amplification of N-term domain of M13's g3p
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAACACTGAGTTTCGTCACCAGTAC
Designer C. Loy
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O18] Tg3p_fusion_Fw
Description Fusion of N-term domain of M13's g3p (standard 23)
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAAAAAAATTATTATTCGCAATTCCTTTAG
Designer C.Loy
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O19] g3p_F
Description g3p
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCTCCGCTGAAACTGTTGAAAGTTG
Designer G. Beauclair
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O20] g3p_R
Description g3p
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAAGACTCCTTATTACGCAG
Designer G. Beauclair
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
[O21] Ompa_linker_F
Description For standardisation of OmpA linker (BBaK103006)
Sequence (5' > 3') TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGAAAGCTACTAAACTGGTACTGG
Designer G. Beauclair
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O22] Ompa_linker_R
Description For standardisation of OmpA linker (BBaK103006)
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTAGAGCTCCCTCCTCCAGAACC
Designer G. Beauclair
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O23] OmpAsignal-TE3_seq_Fw
Description For sequencing of part OmpAsignal-TE3
Sequence (5' > 3') CACAAATAGCGAAAGATGAC
Designer C.Loy
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O24] OmpAsignal-TE3_seq_Rw
Description For sequencing of part OmpAsignal-TE3
Sequence (5' > 3') ATCATCTGCGGGTAATGATG
Designer C.Loy
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O25] VAMP2_Seq_Fw
Description For sequencing of VAMP2 (snare)
Sequence (5' > 3') ACTCACTATAGGGAGACCACA
Designer S.Boumahdi
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O26] VAMP2_Seq_Rv
Description For sequencing of VAMP2 (snare)
Sequence (5' > 3') GGGCTTTGTTAGCAGCCGGAT
Designer S.Boumahdi
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O27] ClyA_seq_Fw
Description For sequencing of clyA after amplification
Sequence (5' > 3') GCAGCTATTTCCAGTCACAG
Designer V.Du
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O28] ClyA_seq_Rw
Description For sequencing of clyA after amplification
Sequence (5' > 3') CGCCCGCAGCAATAGAATAG
Designer V.Du
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O29] PFecA_Fw
Description For signal transduction
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTACGCGGTACTGGATAAACATTTC
Designer R.Bodinier
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O30] PFecA_Rv
Description For signal transduction
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTTTGTTGTGTTCAGCTATGAGT
Designer R.Bodinier
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O31] clyA_RBS_Fw
Description amplify clyA with RBS in the primer (std 10)
Sequence (5' > 3') TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGACTGAAATCGTTGCAGATAAAAC
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O32] clyA fusion_polyG_Fw
Description clyA fusion Fw (with 5-Gly linker)
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGGCGGCGGCGGCGGCACTGAAATCGTTGCAGATAAAAC
Designer G. Cambray
Status Ordered: 07/27 ; Received: no ; Used in wet lab: no

( )

Retrieved from "http://2009.igem.org/Team:Paris/Freezer_Primers"