Team:Paris/Freezer Primers

From 2009.igem.org

(Difference between revisions)
(→Primers)
(→Primers)
Line 35: Line 35:
== Primers ==
== Primers ==
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | <span/ id="PCR"> [O1] Rev P1
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O1"> [O1] Rev P1
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 52: Line 52:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O2] Fwd P2 (ERROR : Do not use)
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O2"> [O2] Fwd P2 (ERROR : Do not use)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 64: Line 64:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
-
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#O1 07/27])
+
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O3] Rev P3
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O3"> [O3] Rev P3
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 81: Line 81:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
-
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#O1 07/27])
+
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O4] Rev P4 (ERROR: Not designed for N-term fusion)
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O4"> [O4] Rev P4 (ERROR: Not designed for N-term fusion)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 98: Line 98:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
-
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#O1 07/27])
+
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O5] Rev P5
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O5"> [O5] Rev P5
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 115: Line 115:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
-
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#O1 07/27])
+
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [06] Fwd P6 (ERROR: without RBS)
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O6"> [06] Fwd P6 (ERROR: without RBS)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 132: Line 132:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
-
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#O1 07/27])
+
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O7] Rev P7 (ERROR: not the good standard for fusion)
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O7"> [O7] Rev P7 (ERROR: not the good standard for fusion)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 149: Line 149:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
-
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#O1 07/27])
+
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O8] Fwd P8 (ERROR: No poly-Gly linker)
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O8"> [O8] Fwd P8 (ERROR: No poly-Gly linker)
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 166: Line 166:
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
-
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#O1 07/27])
+
| style="font-weight:bold;" |Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes ([https://2009.igem.org/Team:Paris/27_July_2009#PCR 07/27])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O9] clyA_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O9"> [O9] clyA_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 189: Line 189:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O10] clyA_fusion_polyG_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O10"> [O10] clyA_fusion_polyG_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 208: Line 208:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O11] ompA_signal_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O11"> [O11] ompA_signal_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 221: Line 221:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
Line 227: Line 227:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O12] ompA_signal_fusion_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O12"> [O12] ompA_signal_fusion_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 240: Line 240:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O13] tolR_II_Fusion_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O13"> [O13] tolR_II_Fusion_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 258: Line 258:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O14] tatABC_RBS_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O14"> [O14] tatABC_RBS_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 275: Line 275:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O15] TE3_fusion_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O15"> [O15] TE3_fusion_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 293: Line 293:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O16] TE3_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O16"> [O16] TE3_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 311: Line 311:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
Line 317: Line 317:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O17] Tg3p_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O17"> [O17] Tg3p_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 330: Line 330:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O18] Tg3p_fusion_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O18"> [O18] Tg3p_fusion_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 348: Line 348:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O19] g3p_F
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O19"> [O19] g3p_F
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 370: Line 370:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O20] g3p_R
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O20"> [O20] g3p_R
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 386: Line 386:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O21] Ompa_linker_F
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O21"> [O21] Ompa_linker_F
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 403: Line 403:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O22] Ompa_linker_R
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O22"> [O22] Ompa_linker_R
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 420: Line 420:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O23] OmpAsignal-TE3_seq_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O23"> [O23] OmpAsignal-TE3_seq_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 437: Line 437:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O24] OmpAsignal-TE3_seq_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O24"> [O24] OmpAsignal-TE3_seq_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 454: Line 454:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O25] VAMP2_Seq_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O25"> [O25] VAMP2_Seq_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 471: Line 471:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O26] VAMP2_Seq_Rv
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O26"> [O26] VAMP2_Seq_Rv
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 488: Line 488:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O27] ClyA_seq_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O27"> [O27] ClyA_seq_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 505: Line 505:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O28] ClyA_seq_Rw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O28"> [O28] ClyA_seq_Rw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 522: Line 522:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O29] PFecA_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O29"> [O29] PFecA_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 539: Line 539:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O30] PFecA_Rv
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O30"> [O30] PFecA_Rv
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 556: Line 556:
{|
{|
-
! colspan="6" style="background: #c5c5c5;" | [O31] clyA_RBS_Fw
+
! colspan="6" style="background: #c5c5c5;" | <span/ id="O31"> [O31] clyA_RBS_Fw
|- style="background: #cbcee0;"
|- style="background: #cbcee0;"
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
|style="background:#0d3e99; color:white; text-align: right;" width=120px|Description
Line 569: Line 569:
|style="background: #0d3e99; color:white;  text-align: right;" | Status
|style="background: #0d3e99; color:white;  text-align: right;" | Status
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
| style="font-weight:bold;" |Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes
-
([https://2009.igem.org/Team:Paris/5_August_2009#A1 08/05])
+
([https://2009.igem.org/Team:Paris/5_August_2009#PCR 08/05])
|}
|}

Revision as of 13:07, 9 August 2009

Freezer

Primers - PCR products - Plasmids - Digestion Products - Unexpected digestion results - Strains (Glycerol stock)


Color code for sticker
Vector Insert PCR product Plasmid Strains Kanamycin Ampicilin Chloranphenicol

Primers

[O1] Rev P1
Description tolR
Sequence (5' > 3') TCTGCTGCAGCGGCCGCTACTAGTATTAGTAAGGCACATCTTTTGCGCCACCG
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O2] Fwd P2 (ERROR : Do not use)
Description tolR
Sequence (5' > 3') TCTGGAATTCGCGGCCGCTTCTAGATGAAATCAACATTGTACCGTTGCTGGACGTACTG
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O3] Rev P3
Description tolA
Sequence (5' > 3') TCTGCTGCAGCGGCCGCTACTAGTATTATTACGGTTTGAAGTCCAATGGCG
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O4] Rev P4 (ERROR: Not designed for N-term fusion)
Description tolA
Sequence (5' > 3') TCTGGAATTCGCGGCCGCTTCTAGAATGGGTAATACTAAAAACAATGGCGC
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O5] Rev P5
Description tatABC
Sequence (5' > 3') TCTGCTGCAGCGGCCGCTACTAGTATTATTATTCTTCAGTTTTTTCGCTTTCTGC
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[06] Fwd P6 (ERROR: without RBS)
Description tatABC
Sequence (5' > 3') TCTGGAATTCGCGGCCGCTTCTAGAATGGGTGGTATCAGTATTTGG
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O7] Rev P7 (ERROR: not the good standard for fusion)
Description clyA fusion
Sequence (5' > 3') TTTCTGCAGCGGCCGCTACTAGTGACTTCAGGTACCTCAAAGAGTGTC
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O8] Fwd P8 (ERROR: No poly-Gly linker)
Description clyA fusion
Sequence (5' > 3') TTTGAATTCGCGGCCGCTTCTAGAATGACTGAAATCGTTGCAGATAAAA
Designer D. Bikard
Status Ordered: 03/07 ; Received: 07/10 ; Used in wet lab: yes (07/27)


[O9] clyA_Rw
Description clyA (for N term fusion)
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGACTTCAGGTACCTCAAAGAG
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: no


[O10] clyA_fusion_polyG_Rw
Description clyA fusion (with 5-Gly linker)
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTGCCGCCGCCGCCGCCGACTTCAGGTACCTCAAAGAG
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O11] ompA_signal_Fw
Description ompA signal for export to periplasm - from expression vector RBS as in pIN-III-ompA-2 vector - keeps vector original RBS
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAACGAGGGCAAAAAATGAAAAAG
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O12] ompA_signal_fusion_Rw
Description ompA signal for export to periplasm - from expression vector pIN-III-ompA-2 - original RBS from the vector
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTGGCCTGCGCTACGGTAGCGAAAC
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O13] tolR_II_Fusion_Fw
Description For fusion of tolR domain II (standard 23)
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGGTCGATCTGCCAGACGCTAC
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)

[O14] tatABC_RBS_Fw
Description Amplification from tatA - contains RBS
Sequence (5' > 3') TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGATGGGTGGTATCAGTATTTGG
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O15] TE3_fusion_Fw
Description Fusion of N-term domain of colicin E3 (standard 23)
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAAGCGGTGGCGATGGACGCGGCCATAAC
Designer C.Loy
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O16] TE3_Rw
Description Amplification of N-term domain of colicin E3 (standard 23)
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAGCGTTCATAATTTCGCTCAG
Designer C.Loy
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O17] Tg3p_Rw
Description Amplification of N-term domain of M13's g3p
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAACACTGAGTTTCGTCACCAGTAC
Designer C. Loy
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O18] Tg3p_fusion_Fw
Description Fusion of N-term domain of M13's g3p (standard 23)
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAAAAAAATTATTATTCGCAATTCCTTTAG
Designer C.Loy
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)


[O19] g3p_F
Description g3p
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCTCCGCTGAAACTGTTGAAAGTTG
Designer G. Beauclair
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O20] g3p_R
Description g3p
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAAGACTCCTTATTACGCAG
Designer G. Beauclair
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no
[O21] Ompa_linker_F
Description For standardisation of OmpA linker (BBaK103006)
Sequence (5' > 3') TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGAAAGCTACTAAACTGGTACTGG
Designer G. Beauclair
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O22] Ompa_linker_R
Description For standardisation of OmpA linker (BBaK103006)
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTAGAGCTCCCTCCTCCAGAACC
Designer G. Beauclair
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O23] OmpAsignal-TE3_seq_Fw
Description For sequencing of part OmpAsignal-TE3
Sequence (5' > 3') CACAAATAGCGAAAGATGAC
Designer C.Loy
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O24] OmpAsignal-TE3_seq_Rw
Description For sequencing of part OmpAsignal-TE3
Sequence (5' > 3') ATCATCTGCGGGTAATGATG
Designer C.Loy
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O25] VAMP2_Seq_Fw
Description For sequencing of VAMP2 (snare)
Sequence (5' > 3') ACTCACTATAGGGAGACCACA
Designer S.Boumahdi
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O26] VAMP2_Seq_Rv
Description For sequencing of VAMP2 (snare)
Sequence (5' > 3') GGGCTTTGTTAGCAGCCGGAT
Designer S.Boumahdi
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O27] ClyA_seq_Fw
Description For sequencing of clyA after amplification
Sequence (5' > 3') GCAGCTATTTCCAGTCACAG
Designer V.Du
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O28] ClyA_seq_Rw
Description For sequencing of clyA after amplification
Sequence (5' > 3') CGCCCGCAGCAATAGAATAG
Designer V.Du
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O29] PFecA_Fw
Description For signal transduction
Sequence (5' > 3') GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTACGCGGTACTGGATAAACATTTC
Designer R.Bodinier
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O30] PFecA_Rv
Description For signal transduction
Sequence (5' > 3') GTTTCTTCCTGCAGCGGCCGCTACTAGTATTTTTGTTGTGTTCAGCTATGAGT
Designer R.Bodinier
Status Ordered: 07/31 ; Received: 08/07 ; Used in wet lab: no


[O31] clyA_RBS_Fw
Description amplify clyA with RBS in the primer (std 10)
Sequence (5' > 3') TTGAATTCGCGGCCGCTTCTAGAAGGAGGTATATAATGACTGAAATCGTTGCAGATAAAAC
Designer G. Cambray
Status Ordered: 07/27 ; Received: 08/05 ; Used in wet lab: yes

(08/05)

Retrieved from "http://2009.igem.org/Team:Paris/Freezer_Primers"