Project progress

A & B (comparator), ideas

Key/lock system, see [http://parts2.mit.edu/wiki/index.php/Berkeley2006-RiboregulatorsMain Riboregulators (Berkeley 2006)]

Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
- Combination of 5 genes; 3 ervan zijn beschikbaar
  - [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Design#Vanilla_Flavour_Production Edinburgh Vanilla production] (Synthese stappen door Edinburgh igem 2007)
- [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp

YCGF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
Probable strain K12
Promotor voor YCGF gene:
- AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTT

TTAACAGAGGCGTAGCATG (bron: [www.ncbi.nlm.nih.gov])

[http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline defficient strain of E.coli: [http://cgsc.biology.yale.edu/Strain.php?ID=64826 YYC912].
Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.'

[http://www.kuleuven.be/rega/mvr/bookmarktsdl.html BioInformatics bookmarks]

create Ideas page
Some idiot replaced the example logo Image:Example_logo.png with his own logo, so all references to it were removed from our wiki