Team:EPF-Lausanne/Notebook

From 2009.igem.org

(Difference between revisions)
 
(198 intermediate revisions not shown)
Line 1: Line 1:
{{EPF-Lausanne09}}
{{EPF-Lausanne09}}
<div CLASS="epfltrick">__TOC__
<div CLASS="epfltrick">__TOC__
-
</div><div CLASS="epfl09">
+
</div><div CLASS="epfl09lab">
-
=Notebook=
+
<html><br><br><br><br><br><br><br><center>
-
===06.07.09===
+
<font size="12" color="#007CBC">Notebook</font>
-
;Wet lab:
+
</center></html>
-
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli, and grown overnight.
+
<br>
-
<br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
+
<br>
-
LOVTAP is in a plasmid called pCal-n (see picture below):
+
<FONT face="arial">
 +
<p align="center"><big>'''{{CURRENTDAY}}.{{CURRENTMONTH}}.{{CURRENTYEAR}} | {{CURRENTTIME}}'''</big></p></FONT>
-
[[Image: pCAL-n.jpg|500px|thumb|center|pCal-n plasmid]]
 
-
<br>Some comments on the plasmid:
+
==Calendar==
-
<br>-CBP is a small peptide with which we could purify LOVTAP protein
+
-
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
+
-
;Cloning strategy:
+
<center><table valign=top>
-
<br>Four forward primers were designed to amplify:
+
<tr valign=top>
-
#Promoter T7, RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
+
<td valign=top>{{ #calendar: title=EPF-Lausanne |year=2009 | month=06 }}
-
#RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
+
</td>
-
#CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
+
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
-
#LOVTAP: gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
+
<td valign=top>
-
<br>One reverse primer were designed: gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
+
{{ #calendar: title=EPF-Lausanne |year=2009 | month=07 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=08 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=09 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=10 }}
 +
</td>
 +
</tr>
 +
</table></center>
 +
<!--<html>
 +
<iframe src="http://www.google.com/calendar/embed?title=EPFL Planning &amp;height=600&amp;wkst=1&amp;bgcolor=%23FFFFFF&amp;src=igem.epfl.09%40gmail.com&amp;color=%23A32929&amp;ctz=Europe%2FRome" style=" border-width:0 " width="800" height="600" frameborder="0" scrolling="no"></iframe>
 +
</html>
-
{| style="color:#1b2c8a;background-color:#0c9;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
+
<html>
-
!align="center"|[[Team:EPF-Lausanne|Home]]
+
<p align="center" class="style1"><a href="#top"><img src="https://static.igem.org/mediawiki/2009/thumb/0/06/Up_arrow.png/50px-Up_arrow.png" alt="Back to top" border="0"></a><br></p>
-
!align="center"|[[Team:EPF-Lausanne/Team|The Team]]
+
</html>
-
!align="center"|[[Team:EPF-Lausanne/Project|The Project]]
+
<br>-->
-
!align="center"|[[Team:EPF-Lausanne/Parts|Parts Submitted to the Registry]]
+
-
!align="center"|[[Team:EPF-Lausanne/Modeling|Modeling]]
+
-
!align="center"|[[Team:EPF-Lausanne/Notebook|Notebook]]
+
-
!align="center"|[[Team:EPF-Lausanne/Lectures|Lectures]]
+
-
!align="center"|[[Team:EPF-Lausanne/Team Management|Team Management]]
+
-
!align="center"|[[Team:EPF-Lausanne/References|References]]
+
-
 
+
-
|}
+
-
 
+
</div><div CLASS="epfl09bouchon"></div>
</div><div CLASS="epfl09bouchon"></div>

Latest revision as of 18:24, 20 October 2009

Contents








Notebook


28.04.2024 | 17:00


Calendar

           
June
MTWTFSS
1 2 3 4 5 6 7
8 9 10 11 12 13 14
15 16 17 18 19 20 21
22 23 24 25 26 27 28
29 30
July
MTWTFSS
    1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30 31
August
MTWTFSS
          1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30
31
September
MTWTFSS
  1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30
October
MTWTFSS
      1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30 31