Team:EPF-Lausanne/Notebook

From 2009.igem.org

(Difference between revisions)
(06.07.09)
 
(152 intermediate revisions not shown)
Line 1: Line 1:
{{EPF-Lausanne09}}
{{EPF-Lausanne09}}
<div CLASS="epfltrick">__TOC__
<div CLASS="epfltrick">__TOC__
-
</div><div CLASS="epfl09">
+
</div><div CLASS="epfl09lab">
-
=Notebook=
+
<html><br><br><br><br><br><br><br><center>
-
===06.07.09===
+
<font size="12" color="#007CBC">Notebook</font>
-
;Wet lab:
+
</center></html>
-
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
+
<br>
-
<br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
+
<br>
-
LOVTAP is in a plasmid called pCal-n (see picture below):
+
<FONT face="arial">
 +
<p align="center"><big>'''{{CURRENTDAY}}.{{CURRENTMONTH}}.{{CURRENTYEAR}} | {{CURRENTTIME}}'''</big></p></FONT>
-
[[Image: pCAL-n.jpg|500px|thumb|center|pCal-n plasmid]]
 
-
<br>Some comments on the plasmid:
+
==Calendar==
-
<br>-CBP is a small peptide with which we could purify LOVTAP protein
+
-
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
+
 +
<center><table valign=top>
 +
<tr valign=top>
 +
<td valign=top>{{ #calendar: title=EPF-Lausanne |year=2009 | month=06 }}
 +
</td>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=07 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=08 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=09 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=10 }}
 +
</td>
 +
</tr>
 +
</table></center>
-
;Cloning strategy:
+
<!--<html>
-
Four forward primers were designed to amplify:
+
<iframe src="http://www.google.com/calendar/embed?title=EPFL Planning &amp;height=600&amp;wkst=1&amp;bgcolor=%23FFFFFF&amp;src=igem.epfl.09%40gmail.com&amp;color=%23A32929&amp;ctz=Europe%2FRome" style=" border-width:0 " width="800" height="600" frameborder="0" scrolling="no"></iframe>
-
<br> 1.Promoter T7, RBS, CBP and LOVTAP:
+
</html>
-
:gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
+
-
2.RBS, CBP and LOVTAP:
+
-
:gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
+
-
3.CBP and LOVTAP:
+
-
:gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
+
-
4.LOVTAP:
+
-
:gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
+
-
One reverse primer were designed:
+
-
:gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
+
-
 
+
-
 
+
-
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
+
-
 
+
-
;People in the lab: Tu, Heidi, Rafael, Basile, Nath
+
-
 
+
-
===07.07.09===
+
-
 
+
-
;Remark for the notebook:
+
-
First, it's great you already started to use the wiki and customised the menu!<br> Then I think we should add the name of the peoples who worked on each part of a process (or at least present the same day). It would allow easy team transitions.<br>
+
-
For the wiki in general, as you did in this page, it is much better not to use html tags.<br>
+
-
We will have a meeting for the modeling on tuesday, I will come to the lab before.<br><br>
+
-
;Wet lab:
+
-
 
+
-
We have to grow the 3 strains generously sent by [mailto:j.beatty@ubc.ca Tom Beatty]
+
-
 
+
-
The three strains are :
+
-
:*''R.Palustris'' CEA001 (wild type) ; should be grown on LB medium only
+
-
:*''R.Palustris'' BPHP1+ ; should be grown on LB with gentamycin (100 micrograms/ml)
+
-
:*''E.Coli'' DH10B (pBPH/hmu0) ; should be grown on LB with gentamycin (20 micorgrams/ml)
+
-
 
+
-
 
+
-
The transformed LOVTAP and TrpR worked well (N.B. the plasmid of TrpR is pUC19 so the antibiotic resistance is Amp -> see below)
+
-
 
+
-
 
+
-
 
+
-
[[Image: RTEmagicC_puc19_2.gif.gif|500px|thumb|center|pUC19 plasmid]]
+
-
 
+
-
 
+
-
We did the glycerol stock, located in the -80 fridge, first floor of the iGEM compartement.
+
-
 
+
-
Then, a miniprep was done with both cultures.
+
-
A LOVTAP plasmid aliquot was done, a TrpR plasmid aliquot was done, located in the -20 fridge, 2nd floor.
+
-
 
+
-
 
+
-
 
+
-
'''People in the lab'''
+
-
:Tu, Rafael, Nath, Heidi, Basile
+
-
 
+
-
 
+
-
;Cloning strategy:
+
-
To design plasmids : software Vector NTI
+
-
 
+
-
{| style="color:#1b2c8a;background-color:#0c9;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
+
-
!align="center"|[[Team:EPF-Lausanne|Home]]
+
-
!align="center"|[[Team:EPF-Lausanne/Team|The Team]]
+
-
!align="center"|[[Team:EPF-Lausanne/Project|The Project]]
+
-
!align="center"|[[Team:EPF-Lausanne/Parts|Parts Submitted to the Registry]]
+
-
!align="center"|[[Team:EPF-Lausanne/Modeling|Modeling]]
+
-
!align="center"|[[Team:EPF-Lausanne/Notebook|Notebook]]
+
-
!align="center"|[[Team:EPF-Lausanne/Lectures|Lectures]]
+
-
!align="center"|[[Team:EPF-Lausanne/Team Management|Team Management]]
+
-
!align="center"|[[Team:EPF-Lausanne/References|References]]
+
-
 
+
-
|}
+
 +
<html>
 +
<p align="center" class="style1"><a href="#top"><img src="https://static.igem.org/mediawiki/2009/thumb/0/06/Up_arrow.png/50px-Up_arrow.png" alt="Back to top" border="0"></a><br></p>
 +
</html>
 +
<br>-->
</div><div CLASS="epfl09bouchon"></div>
</div><div CLASS="epfl09bouchon"></div>

Latest revision as of 18:24, 20 October 2009

Contents








Notebook


28.04.2024 | 10:39


Calendar

           
June
MTWTFSS
1 2 3 4 5 6 7
8 9 10 11 12 13 14
15 16 17 18 19 20 21
22 23 24 25 26 27 28
29 30
July
MTWTFSS
    1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30 31
August
MTWTFSS
          1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30
31
September
MTWTFSS
  1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30
October
MTWTFSS
      1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30 31