User contributions
From 2009.igem.org
(Latest | Earliest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)
- 03:24, 22 October 2009 (diff | hist) Team:Brown/Team
- 03:23, 22 October 2009 (diff | hist) Team:Brown/Team
- 03:18, 22 October 2009 (diff | hist) Team:Brown/Team
- 03:18, 22 October 2009 (diff | hist) File:V Brown.JPG (uploaded a new version of "Image:V Brown.JPG") (top)
- 03:07, 22 October 2009 (diff | hist) Team:Brown/Project
- 03:06, 22 October 2009 (diff | hist) Template:Brown
- 03:03, 22 October 2009 (diff | hist) Team:Brown/Project Implications
- 03:01, 22 October 2009 (diff | hist) Team:Brown/Notebook Protocols/sdspage (top)
- 03:01, 22 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/sdspage (New page: {{Brown}} '''SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)''' The standard method to separate proteins in a complex mixture according to mass (formally, according to their ability...)
- 02:58, 22 October 2009 (diff | hist) Team:Brown/Project Implications
- 02:57, 22 October 2009 (diff | hist) N File:Part submission.png (top)
- 02:54, 22 October 2009 (diff | hist) Team:Brown/Project Introduction (top)
- 02:54, 22 October 2009 (diff | hist) Team:Brown/Links Sponsors (→Financial, logistical, and spatial sponsors:) (top)
- 02:53, 22 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:51, 22 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:51, 22 October 2009 (diff | hist) Team:Brown/Links Acknowledgements (top)
- 02:50, 22 October 2009 (diff | hist) Team:Brown/Links Acknowledgements (→Acknowledgements)
- 02:50, 22 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:49, 22 October 2009 (diff | hist) Team:Brown/Notebook meetings (top)
- 02:49, 22 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 02:49, 22 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 02:49, 22 October 2009 (diff | hist) Team:Brown
- 02:48, 22 October 2009 (diff | hist) Team:Brown
- 02:47, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/9-15-09 (New page: {{Brown}} '''iGEM Meeting''' '''B25''' '''9/15/09, 8AM''' *Team 1 update: **Need pNoTat to express EV131! **Binding assay by next week **Will try pBlueScript *Team 2 update...) (top)
- 02:47, 22 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 02:47, 22 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 02:46, 22 October 2009 (diff | hist) Team:Brown/Notebook Protocols (→Protocols) (top)
- 02:46, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/8-17-09 (New page: {{Brown}} '''iGEM Meeting''' '''8-17-09''' '''SFH 218''' '''9 AM''' *Team 1 update: **Today they are making the Blotto solution with 6-His **Purchased Qiagen nickel column puri...) (top)
- 02:45, 22 October 2009 (diff | hist) Team:Brown/Parts
- 02:45, 22 October 2009 (diff | hist) Team:Brown/Parts
- 02:44, 22 October 2009 (diff | hist) Team:Brown/Parts (→Biobricks...saving one sneeze at a time!)
- 02:43, 22 October 2009 (diff | hist) Team:Brown/Project Implications (→Human Practices)
- 02:42, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/8-10-09 (New page: {{Brown}} '''iGEM Meeting 8-10-09''' '''SFH 218''' '''Attendees: Diana, Adrian''' *Team 1 update **Got EV131 into pNoTat **Growing in competent BL21 **IPTG induction **Last year...) (top)
- 02:42, 22 October 2009 (diff | hist) Team:Brown/Project All Together
- 02:42, 22 October 2009 (diff | hist) Team:Brown/Project All Together (→Allergene: The Genetic Construct in Action)
- 02:41, 22 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:41, 22 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:41, 22 October 2009 (diff | hist) Team:Brown/Project S.epidermidis (→The Chassis: Staphyloccocus Epidermidis)
- 02:40, 22 October 2009 (diff | hist) Team:Brown/Project HBP (→rEV131: High-Affinity Histamine Binding Protein)
- 02:38, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/8-3-09 (New page: {{Brown}} '''iGEM Meeting 8-3-09''' '''SFH 218''' *9:06: UTRA poster presentation. Call Kinko’s and let them know. Or contact Judy Nathanson for printing next door for much c...) (top)
- 02:36, 22 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 02:36, 22 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 02:36, 22 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor (→Histamine Sensor)
- 02:35, 22 October 2009 (diff | hist) Team:Brown/Project Introduction (→The Allergic Response)
- 02:34, 22 October 2009 (diff | hist) Team:Brown/Project (→Project Abstract)
- 02:30, 22 October 2009 (diff | hist) Template:Brown
- 02:27, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-8-09 (top)
- 02:23, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-3-09 (New page: {{Brown}} '''Brown iGEM Meeting''' '''June 2, 2009''' '''WebEx Conference Call''' *Attendees: Steph, Will, Indu, Eli, Michael *8:20: Steph will be researching S. Aureus express...) (top)
- 02:21, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/5-31-09 (top)
- 02:19, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/5-27-09 (top)
- 02:17, 22 October 2009 (diff | hist) Team:Brown/Team
- 02:16, 22 October 2009 (diff | hist) N File:About-brown-igem-bar-1.png (top)
- 02:15, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/5-6-09 (top)
- 02:15, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/5-6-09
- 02:13, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/5-4-09 (top)
- 02:09, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/4-22-09 (top)
- 02:05, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/10-16-09 (top)
- 02:01, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/10-16-09 (New page: {{Brown}} '''Brown iGEM 2009 Meeting''' '''October 16, 2009'' *Tasks Before Wednesday: **Mailing Biobrick parts (Ahmad) ***Deadline is Monday at 5PM ***Ahmad can you send us the...)
- 01:58, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/9-11-09 (top)
- 01:54, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/7-13-09 (New page: {{Brown}} '''iGEM Meeting Minutes ''' '''July 13, 2009 ''' '''9:00 AM ''' '''SFH 218 ''' *9:07AM: Team 1 update **Sent out EV131 for sampling last week, the gene is in there **...) (top)
- 01:51, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/7-6-09 (New page: {{Brown}} '''iGEM Meeting Minutes- 7/6/09 ''' '''9:05 am''' *Update from Team 1 **Failed digests and PCR- could it be poor technique, or insert not in pBluescript? **Drop off fed...) (top)
- 01:42, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-29-09 (New page: {{Brown}} {{Brown}} '''iGEM Advising Meeting''' '''With Gary, Diana, Adrian''' '''SFH 218''' '''June 29, 2009''' *9:02: Team 3 explains the situation. We are keeping the to...) (top)
- 01:37, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-22-09 (top)
- 01:36, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-22-09 (New page: {{Brown}} '''Advising Meeting '''Gary, Adrian, Diana '''June 22, 2009''' '''SFH 218''' *9:12 AM: Meeting starts *9:12: Group 1 progress. Received and purified the DNA in pBluescrip...)
- 01:33, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-19-09 (top)
- 01:32, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-19-09
- 01:31, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-19-09
- 01:30, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-19-09 (New page: {{Brown}} '''BioSafety Meeting with Chris Harwood''' '''June 19, 2009'' *Can we use a BSL2? **Need Institutional Biosafety Committee approval **Chris can get a provisional approval,...)
- 01:29, 22 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs (top)
- 01:27, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-17-09 (top)
- 01:25, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-17-09 (New page: {{Brown}} '''June 17, 2009''' *Implementing a timed death system after it secretes enough protein **quorum sensing? Limiting population of S. aureus in nose *Histamine responsive tra...)
- 01:22, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-16-09 (New page: {{Brown}} '''Team Tasks- June 16, 2009''' *Team 1: EV131- Indu, Ahmad, Minoo *Team 2: S.aureus- Eli, Flora, Will *Team 3: Bistable toggle- Michael, Ashley, Steph *Tasks on hand: ...) (top)
- 01:19, 22 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 01:17, 22 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-15-09 (top)
- 01:16, 22 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-15-09 (New page: {{Brown}} '''Brown iGEM Meeting ''' '''Monday June 15, 2009 ''' Sidney Frank Hall Auditorium *9:00 AM: The whole gang is back! *9:23: Will proposes dropping the Safe Cell project, as...)
- 01:06, 22 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 00:59, 22 October 2009 (diff | hist) N File:Weekly-logsbrown.png (top)
- 00:25, 22 October 2009 (diff | hist) Team:Brown
- 00:17, 22 October 2009 (diff | hist) File:Quorum sensing construct.jpg (uploaded a new version of "Image:Quorum sensing construct.jpg") (top)
- 00:09, 22 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 00:07, 22 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 00:06, 22 October 2009 (diff | hist) File:Plasmid with HBP+secretion tag.jpg (uploaded a new version of "Image:Plasmid with HBP+secretion tag.jpg") (top)
- 23:54, 21 October 2009 (diff | hist) Team:Brown/Project All Together
- 23:53, 21 October 2009 (diff | hist) N File:Human practices brown button.png (top)
- 23:52, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 23:51, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 23:51, 21 October 2009 (diff | hist) N File:Brown system schematic button.png (top)
- 23:51, 21 October 2009 (diff | hist) File:S.epibutton.gif (uploaded a new version of "Image:S.epibutton.gif") (top)
- 23:50, 21 October 2009 (diff | hist) File:Teambutton.gif (uploaded a new version of "Image:Teambutton.gif") (top)
- 23:49, 21 October 2009 (diff | hist) File:Partsbutton.gif (uploaded a new version of "Image:Partsbutton.gif") (top)
- 23:47, 21 October 2009 (diff | hist) Team:Brown/Project HBP
- 23:47, 21 October 2009 (diff | hist) N File:Brown epidermidis.png (top)
- 23:46, 21 October 2009 (diff | hist) File:Notebookbutton.gif (uploaded a new version of "Image:Notebookbutton.gif") (top)
- 23:45, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 23:45, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 23:43, 21 October 2009 (diff | hist) N File:Brown hbp bottom 3.png (top)
- 23:43, 21 October 2009 (diff | hist) File:Learnmoreallergiesbutton.gif (uploaded a new version of "Image:Learnmoreallergiesbutton.gif") (top)
- 23:42, 21 October 2009 (diff | hist) Team:Brown/Project Introduction (→The Allergic Response)
- 23:41, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 23:41, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 23:40, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 23:39, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 23:39, 21 October 2009 (diff | hist) N File:Brown-button-2-histamine-sensor.png (top)
- 23:37, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:36, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:36, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:36, 21 October 2009 (diff | hist) File:Implicationsbutton.gif (uploaded a new version of "Image:Implicationsbutton.gif") (top)
- 23:35, 21 October 2009 (diff | hist) File:Histaminesensorbutton.gif (uploaded a new version of "Image:Histaminesensorbutton.gif") (top)
- 23:35, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:34, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:34, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:33, 21 October 2009 (diff | hist) File:Hbpbutton.gif (uploaded a new version of "Image:Hbpbutton.gif") (top)
- 23:33, 21 October 2009 (diff | hist) N File:Brown-button-1a.png (top)
- 23:31, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:30, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:30, 21 October 2009 (diff | hist) N File:Brown-bottom-1.png (top)
- 23:28, 21 October 2009 (diff | hist) Team:Brown/Project
- 23:28, 21 October 2009 (diff | hist) Team:Brown/Project (→Project Abstract)
- 23:27, 21 October 2009 (diff | hist) Team:Brown/Project (→Project Abstract)
- 23:27, 21 October 2009 (diff | hist) File:Alltogetherbutton.gif (uploaded a new version of "Image:Alltogetherbutton.gif") (top)
- 23:26, 21 October 2009 (diff | hist) N File:All together button bottom 1.png (top)
- 23:26, 21 October 2009 (diff | hist) File:Projectabstractbutton.gif (uploaded a new version of "Image:Projectabstractbutton.gif") (top)
- 23:19, 21 October 2009 (diff | hist) Team:Brown/Project (→Project Abstract)
- 23:18, 21 October 2009 (diff | hist) Team:Brown/Project (→Project Abstract)
- 23:15, 21 October 2009 (diff | hist) Template:Brown
- 23:15, 21 October 2009 (diff | hist) N File:Bottom-the-allergic-response-brown.png (top)
- 23:14, 21 October 2009 (diff | hist) Template:Brown
- 23:03, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 23:03, 21 October 2009 (diff | hist) N File:Tackling-allergies.png (top)
- 23:03, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 23:02, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 22:56, 21 October 2009 (diff | hist) Team:Brown
- 22:56, 21 October 2009 (diff | hist) Team:Brown
- 22:52, 21 October 2009 (diff | hist) Team:Brown
- 22:51, 21 October 2009 (diff | hist) Team:Brown
- 22:47, 21 October 2009 (diff | hist) Template:Brown
- 22:41, 21 October 2009 (diff | hist) Team:Brown
- 22:37, 21 October 2009 (diff | hist) Team:Brown
- 22:32, 21 October 2009 (diff | hist) Team:Brown
- 22:31, 21 October 2009 (diff | hist) Team:Brown
- 22:30, 21 October 2009 (diff | hist) Team:Brown
- 22:27, 21 October 2009 (diff | hist) Team:Brown
- 22:26, 21 October 2009 (diff | hist) Team:Brown
- 22:22, 21 October 2009 (diff | hist) Team:Brown
- 22:19, 21 October 2009 (diff | hist) Team:Brown
- 22:18, 21 October 2009 (diff | hist) Team:Brown
- 22:13, 21 October 2009 (diff | hist) Team:Brown
- 22:13, 21 October 2009 (diff | hist) Team:Brown/Project All Together
- 22:02, 21 October 2009 (diff | hist) Team:Brown
- 21:59, 21 October 2009 (diff | hist) Team:Brown
- 21:27, 21 October 2009 (diff | hist) Team:Brown
- 21:23, 21 October 2009 (diff | hist) N File:Projectabstractbutton.gif
- 21:20, 21 October 2009 (diff | hist) File:Histaminesensorbutton.gif (uploaded a new version of "Image:Histaminesensorbutton.gif")
- 21:18, 21 October 2009 (diff | hist) File:S.epibutton.gif (uploaded a new version of "Image:S.epibutton.gif")
- 21:00, 21 October 2009 (diff | hist) File:Implicationsbutton.gif (uploaded a new version of "Image:Implicationsbutton.gif")
- 20:51, 21 October 2009 (diff | hist) Team:Brown/Team
- 20:49, 21 October 2009 (diff | hist) N File:Diana D.JPG
- 20:44, 21 October 2009 (diff | hist) Team:Brown
- 20:44, 21 October 2009 (diff | hist) File:Brownbanner.gif (uploaded a new version of "Image:Brownbanner.gif") (top)
- 20:43, 21 October 2009 (diff | hist) Team:Brown
- 20:43, 21 October 2009 (diff | hist) Team:Brown
- 20:41, 21 October 2009 (diff | hist) Team:Brown
- 20:41, 21 October 2009 (diff | hist) Team:Brown
- 20:40, 21 October 2009 (diff | hist) Team:Brown
- 20:40, 21 October 2009 (diff | hist) N File:Brownbanner.gif
- 20:29, 21 October 2009 (diff | hist) Team:Brown
- 20:27, 21 October 2009 (diff | hist) Team:Brown
- 20:23, 21 October 2009 (diff | hist) N File:1-big.jpg (top)
- 20:13, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team3 Notebook (top)
- 19:18, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team3 Notebook
- 19:15, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team3 Notebook
- 19:13, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team3 Notebook
- 19:11, 21 October 2009 (diff | hist) N Team:Brown/Notebook weekly Logs/Weekly Team3 Notebook (New page: {{Brown}} S.epidermidis and Secretion Notebook ---- 07/16/09 - 07/23/09 *Date: 07/16/09 **We are going to use pSB1A3 instead of PSB1C3 (Ampicillin resistance instead chloramphenicol r...)
- 18:51, 21 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 18:50, 21 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 18:47, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team2 Notebook
- 18:36, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team2 Notebook
- 18:08, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 18:07, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 18:06, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 18:05, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 18:04, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 18:02, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 17:55, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 17:52, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 17:49, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 17:39, 21 October 2009 (diff | hist) Team:Brown
- 17:37, 21 October 2009 (diff | hist) Team:Brown
- 15:51, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 15:49, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 15:48, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 15:46, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 15:46, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 15:42, 21 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 06:31, 21 October 2009 (diff | hist) Team:Brown/Links Acknowledgements
- 06:30, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 06:27, 21 October 2009 (diff | hist) Team:Brown
- 06:26, 21 October 2009 (diff | hist) Team:Brown
- 06:21, 21 October 2009 (diff | hist) Team:Brown
- 06:13, 21 October 2009 (diff | hist) Team:Brown/Parts
- 06:13, 21 October 2009 (diff | hist) Team:Brown/Parts
- 06:12, 21 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 06:12, 21 October 2009 (diff | hist) Team:Brown/Links Sponsors (→Financial, logistical, and spatial sponsors:)
- 06:11, 21 October 2009 (diff | hist) Team:Brown/Links Sponsors
- 06:10, 21 October 2009 (diff | hist) N File:Thermofisher.png (top)
- 06:10, 21 October 2009 (diff | hist) N File:Brown mdl logo.png (top)
- 06:09, 21 October 2009 (diff | hist) Team:Brown/Links Sponsors
- 06:08, 21 October 2009 (diff | hist) File:Brown research logo.png (uploaded a new version of "Image:Brown research logo.png") (top)
- 06:08, 21 October 2009 (diff | hist) N File:Brown primo.png (top)
- 06:07, 21 October 2009 (diff | hist) N File:Brown research logo.png
- 06:07, 21 October 2009 (diff | hist) N File:Brown mcb.png (top)
- 06:07, 21 October 2009 (diff | hist) N File:Brown div engineering.png (top)
- 06:07, 21 October 2009 (diff | hist) N File:Brown comp bio.png (top)
- 06:07, 21 October 2009 (diff | hist) N File:Brown biomed logo.png (top)
- 06:06, 21 October 2009 (diff | hist) Team:Brown/Links Acknowledgements
- 06:04, 21 October 2009 (diff | hist) Team:Brown/Links Acknowledgements
- 06:02, 21 October 2009 (diff | hist) N Team:Brown/Links Acknowledgements (New page: {{Brown}} '''We would like to thank the following individuals without whom this project would not have been possible:''' *Dr. Gary Wessel, for his invaluable advice, unremitting patie...)
- 04:22, 21 October 2009 (diff | hist) Team:Brown
- 04:21, 21 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 04:21, 21 October 2009 (diff | hist) Team:Brown/Project Implications
- 04:20, 21 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 04:18, 21 October 2009 (diff | hist) Template:Brown
- 04:16, 21 October 2009 (diff | hist) Template:Brown
- 04:15, 21 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 04:14, 21 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 04:12, 21 October 2009 (diff | hist) Team:Brown
- 04:11, 21 October 2009 (diff | hist) Team:Brown
- 04:10, 21 October 2009 (diff | hist) Team:Brown
- 04:08, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 04:07, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 04:07, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 04:06, 21 October 2009 (diff | hist) Team:Brown/Project
- 04:03, 21 October 2009 (diff | hist) Team:Brown/Parts/OmpC
- 04:03, 21 October 2009 (diff | hist) Team:Brown/Parts/OmpC
- 04:01, 21 October 2009 (diff | hist) Team:Brown/Parts/Tar-EnvZ (top)
- 04:01, 21 October 2009 (diff | hist) Team:Brown/Parts/Tar-EnvZ
- 04:01, 21 October 2009 (diff | hist) Team:Brown/Parts/Tar-EnvZ
- 04:00, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:59, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:58, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:57, 21 October 2009 (diff | hist) Team:Brown/Parts (→Biobricks)
- 03:55, 21 October 2009 (diff | hist) Team:Brown/Parts/EV131 (top)
- 03:54, 21 October 2009 (diff | hist) N Team:Brown/Parts/EV131 (New page: {{Brown}} ==EV131 Sequence== gccgcgacggaacttcgaaggaagtcagcatgaagcttctcatactctctcttgccctcgtcctcgccctcagccaggttaagggaaatcagccagattgggccgatgaagcggcaaatggtgcacaccaagacgcctggaagagtctgaaagc...)
- 03:51, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:49, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:47, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:45, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:41, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:38, 21 October 2009 (diff | hist) Team:Brown/Parts
- 03:36, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 03:34, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 03:33, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 03:33, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 03:32, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 03:27, 21 October 2009 (diff | hist) Team:Brown/Project HBP
- 03:17, 21 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 02:56, 21 October 2009 (diff | hist) N File:Ev131cloning.jpg (top)
- 02:28, 21 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:20, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:19, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:10, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:04, 21 October 2009 (diff | hist) N File:Staphylococcus epidermidis.jpg (top)
- 01:56, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 01:56, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 01:55, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 01:55, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 01:53, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 01:52, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 01:52, 21 October 2009 (diff | hist) Team:Brown/Project Introduction
- 01:50, 21 October 2009 (diff | hist) Team:Brown/Project
- 01:49, 21 October 2009 (diff | hist) Team:Brown/Project
- 01:47, 21 October 2009 (diff | hist) Team:Brown/Project (→Project Abstract)
- 01:45, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 01:45, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 01:44, 21 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 01:43, 21 October 2009 (diff | hist) Team:Brown/Team
- 01:41, 21 October 2009 (diff | hist) Team:Brown/Team
- 01:38, 21 October 2009 (diff | hist) Team:Brown/Team
- 21:39, 20 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/CFU (New page: {{Brown}} How to calculate CFU’s ---- (pg plasmid DNA/total reaction volume) x plated volume = pg DNA plated (avg # of colonies/pg DNA plated) x (10^6 pg / µg) = (# of transf...)
- 21:36, 20 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/immunoblotting (New page: {{Brown}} Immunoblotting (Western Blotting) Adapted for Spot-Blotting ---- Reagents needed: 1) Blotto (per liter, 10.8 gms NaCl; 20 mM Trip, pH 8.0; 30 gms not-fat dry milk; 0.0...)
- 21:35, 20 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/redigest (New page: {{Brown}} DNA digestion protocol & hints ---- Overview: Although it is pretty standard to digest DNA with restriction enzymes, here are a standardized protocol and some hints...)
- 21:34, 20 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/glycerolstocks (New page: {{Brown}} Glycerol Stocks ---- Every construct, whether created in the Stockinger lab or imported from another lab into the Stockinger lab, must be put away and maintained as a ...)
- 21:31, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/PCR
- 21:30, 20 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/PCR (New page: {{Brown}} Protocol: Polymerase Chain Reaction ---- Background/Purpose Polymerase Chain Reaction (PCR) is used to amplify DNA segments by way of template strands, primers, and DNA poly...)
- 21:29, 20 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/primerresusp (New page: {{Brown}} Primer resuspension ---- Goal: 5pM/ul. This is a 1xstock solution. Protocol: 1) Identify the nM amount on the tube and resuspend the primers in 10x (in ul) water, ...)
- 21:28, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/movingdna
- 21:28, 20 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/movingdna (New page: {{Brown}} Moving DNA (subcloning) Often pieces of DNA (biobricks, PCR fragments, promoters, etc) need to be moved into a different vector, combined with other pieces, or modified ...)
- 21:27, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/bacterialbasics
- 21:26, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/bacterialbasics
- 21:26, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/bacterialbasics (→Bacterial Basics)
- 21:26, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/bacterialbasics
- 21:25, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/bacterialbasics
- 21:25, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/bacterialbasics
- 21:25, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/bacterialbasics
- 21:25, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols/bacterialbasics
- 21:24, 20 October 2009 (diff | hist) N Team:Brown/Notebook Protocols/bacterialbasics (New page: {{Brown}} Bacterial Basics ---- Bacteria Structure ---- Bacteria are prokaryotic organisms. They are surrounded by a firm cell wall that helps maintain their structure. Bacteria h...)
- 21:21, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 21:20, 20 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 21:09, 20 October 2009 (diff | hist) Team:Brown/Notebook Meetings/9-11-09
- 21:07, 20 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/9-11-09 (New page: {{Brown}} 9/11/09 iGEM Meeting SFH 218 8:00 AM: Gary reminds us of our responsibility. We need to plan this semester! These next few weeks are the most important Adrian: Deadlines ...)
- 21:05, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 21:03, 20 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-8-09
- 21:03, 20 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-8-09 (New page: {{Brown}} iGEM Meeting June 8, 2009 6:00 PM PST 6:19: We discovered we had video chat capabilities. It made the meeting AWESOME. 6:23: Possible 3rd kill switch: SulA stops FtsZ gene...)
- 21:02, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 21:02, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 21:00, 20 October 2009 (diff | hist) Team:Brown/Notebook Meetings/6-2-09 (top)
- 21:00, 20 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/6-2-09 (New page: {{Brown}} Brown iGEM Meeting June 3, 2009 WebEx Conference Call Attendees: Steph, Will, Indu, Eli, Michael 8:20: Steph will be researching S. Aureus expression vectors, and the natur...)
- 20:59, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 20:59, 20 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/5-31-09 (New page: {{Brown}} Brown iGEM 2009 WebEx Conference Call May 31, 2009 8:00 PM Attendees: Will, Eli, Indu, Michael 8:00: Will introduces new idea to deal with localization problem using S. ...)
- 20:57, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 18:14, 20 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/5-27-09 (New page: {{Brown}} Brown iGEM 2009 Phone Conference 5/27/09 (Pacific Time) 8:20PM: Meeting starts after a lot of technical difficulties 8:22: Brad Lowell at Harvard does not have UCP2, Inv...)
- 18:12, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 18:11, 20 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/5-6-09 (New page: {{Brown}} iGEM 2009 Meeting May 6, 2009 5:09: Meeting begins in SFH 218, with Adrian and Dana. Today we are presenting our powerpoints for Friday’s panel meeting 5:09: Minoo: eng...)
- 18:11, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 18:11, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 18:10, 20 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/5-4-09 (New page: {{Brown}} iGEM 2009 Meeting May 4, 2009 6:13PM: Meeting starts in SFH Auditorium. Discussed War War Ko’s name. 6:14: Project ideas. Adding Minoo’s “Pro Bread” to the list ...)
- 18:10, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 18:09, 20 October 2009 (diff | hist) N Team:Brown/Notebook Meetings/4-22-09 (New page: {{Brown}} iGEM 2009 Meeting April 22, 2009 9:40PM: Meeting begins in the SciLi Basement 9:43: iGEM account, Google groups account, Mathworks; email Neil for google group invitation!...)
- 18:09, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 18:08, 20 October 2009 (diff | hist) Team:Brown/Notebook meetings
- 18:08, 20 October 2009 (diff | hist) N Team:Brown/Notebook meetings (New page: Team Meetings- Minutes ---- [https://2009.igem.org/Team:Brown/Notebook_Meetings/4-22-09 April 22, 2009] [https://2009.igem.org/Team:Brown/Notebook_Meetings/4-22-09 April 22, 2009] [http:/...)
- 18:05, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/Detergent (New page: {{Brown}} Making 1% Lab Detergent ---- • Making 50ml of Lab Detergent. 1. 5g of Lab detergent powder 2. 50ml of ddH2O.) (top)
- 18:04, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/TAE (New page: {{Brown}} Making 1x TAE Buffer ---- • Making 1L of TAE Buffer 1. 100 ml of 10x TAE Buffer 2. 900 ml of ddH2O.) (top)
- 18:03, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/Glycerolstocks (top)
- 18:03, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/Glycerolstocks (New page: {{Brown}} Preparing 15% Glycerol stock for E.Coli ---- • Making 10ml of 15% Glycerol + LB 1. 0.216 g of LB Powder 2. 1.5 ml of 100% Glycerol 3. 8.5 ml of ddH2O ➢ Aliquot into 1m...)
- 18:02, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/Tetracycline (New page: {{Brown}} Making Tetracycline (Tet) Stock = 100x (Meaning use 1ul of Tet Stock for Every 1ml of Medium) → [50mg/ml] ---- • Making 10 of 1ml aliquots 1. 0.125g of Tet (Prevent ...) (top)
- 07:03, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/Ampicillin (top)
- 07:03, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/Ampicillin (New page: {{Brown}} Making Ampicillin (Amp) Stock = 100x (Meaning use 1ul of Amp Stock for Every 1ml of Medium) → [50ug/ml] ---- • Making 10 of 1ml aliquots 1. 0.5g of Amp (Prevent it from ...)
- 07:02, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/SMMP (top)
- 07:02, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/SMMP (New page: {{Brown}} Making SMMP Medium ( Recovery Medium for Electroporated Staphylococcus epidermidis cells) ---- • Making 100ml of SMMP 1. 55.5 parts SMM Buffer a. Sucrose 18.8263g b. Male...)
- 06:54, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/SOB (top)
- 06:53, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/SOB (New page: {{Brown}} Making SOB Medium ( For growing competent E.Coli cells) ---- • Making 1L of SOB • Please look at Pg 1356 of the Lab Reference Book for details. 1. 20g Bacto tryptone 2...)
- 06:52, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/TSBPlates (New page: {{Brown}} Making Tyrpticase Soy Broth (TSB) Plates (For 1L = ~ 30plates) ---- 1. Add 30g of TSB into 2. 1 L ddH2O in 2L of Flask 3 Swirl the flask until all the LB is dissolved. 4...) (top)
- 06:51, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/LBPlate (New page: {{Brown}} Making LB Plates (For 1L = ~ 30plates) ---- 1. Add 20g LB into 2. 1 L ddH2O in 2L of Flask o Swirl the flask until all the LB is dissolved. 3. Add 15g Agar o Bring the so...) (top)
- 06:48, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/TSB (top)
- 06:48, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/TSB (New page: {{Brown}} Making Tyrpticase Soy Broth (TSB) - (Broth) = 1L Worth ---- 1. Add 30g of TSB into 2. 1 L ddH2O in 2L of Flask ➢ Swirl the flask until all the TSB is dissolved. ➢ Aliqu...)
- 06:47, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:46, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:46, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/LB (top)
- 06:45, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes/LB
- 06:45, 20 October 2009 (diff | hist) N Team:Brown/Notebook Recipes/LB (New page: Making LB (Broth) ---- 1. Add 20g LB into 2. 1 L ddH2O in 2L of Flask ➢ Swirl the flask until all the LB is dissolved. ➢ Aliquot them into smaller volume (usually into 100ml bottle...)
- 06:45, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:44, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:43, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:43, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:42, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:39, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:35, 20 October 2009 (diff | hist) Team:Brown/Notebook Recipes
- 06:12, 20 October 2009 (diff | hist) Team:Brown/Parts
- 05:52, 20 October 2009 (diff | hist) Team:Brown/Project Introduction
- 05:49, 20 October 2009 (diff | hist) Team:Brown/Project Introduction
- 05:43, 20 October 2009 (diff | hist) N File:Allergic Response.ppt (top)
- 05:43, 20 October 2009 (diff | hist) Team:Brown
- 05:42, 20 October 2009 (diff | hist) Team:Brown
- 05:41, 20 October 2009 (diff | hist) Team:Brown
- 05:33, 20 October 2009 (diff | hist) Team:Brown/Project Introduction (/* A Synthetic Approach to Treating Allergic Rhinitis: Engineering Staphyloccocus Epidermidis to Secrete High-Affinity Histamine Binding Protein in Response to Elevated Levels of Histamine due to an A)
- 05:33, 20 October 2009 (diff | hist) Team:Brown/Project Introduction (/* A Synthetic Approach to Treating Allergic Rhinitis: Engineering Staphyloccocus Epidermidis to Secrete High-Affinity Histamine Binding Protein in Response to Elevated Levels of Histamine due to an A)
- 05:31, 20 October 2009 (diff | hist) Team:Brown/Project Introduction
- 04:31, 20 October 2009 (diff | hist) Team:Brown/Project
- 04:31, 20 October 2009 (diff | hist) Team:Brown/Project
- 04:30, 20 October 2009 (diff | hist) Team:Brown/Project
- 04:29, 20 October 2009 (diff | hist) Template:Brown
- 04:24, 20 October 2009 (diff | hist) Team:Brown
- 04:23, 20 October 2009 (diff | hist) Team:Brown
- 04:22, 20 October 2009 (diff | hist) Team:Brown
- 04:22, 20 October 2009 (diff | hist) Team:Brown
- 04:21, 20 October 2009 (diff | hist) Team:Brown
- 04:17, 20 October 2009 (diff | hist) Team:Brown
- 04:17, 20 October 2009 (diff | hist) Team:Brown
- 04:17, 20 October 2009 (diff | hist) Team:Brown
- 04:17, 20 October 2009 (diff | hist) Team:Brown
- 04:15, 20 October 2009 (diff | hist) Team:Brown
- 04:05, 20 October 2009 (diff | hist) N Team:Brown/Project All Together (New page: {{Brown}})
- 04:03, 20 October 2009 (diff | hist) N Team:Brown/Project Quorum Sensor (New page: {{Brown}}) (top)
- 03:55, 20 October 2009 (diff | hist) Team:Brown
- 03:44, 20 October 2009 (diff | hist) Team:Brown
- 03:42, 20 October 2009 (diff | hist) Team:Brown
- 03:41, 20 October 2009 (diff | hist) Template:Brown
- 03:38, 20 October 2009 (diff | hist) Team:Brown/Project
- 03:37, 20 October 2009 (diff | hist) Team:Brown/Project
- 03:08, 20 October 2009 (diff | hist) Team:Brown
- 03:08, 20 October 2009 (diff | hist) Team:Brown
- 03:06, 20 October 2009 (diff | hist) Team:Brown
- 03:06, 20 October 2009 (diff | hist) Team:Brown
- 03:03, 20 October 2009 (diff | hist) Team:Brown
- 02:34, 20 October 2009 (diff | hist) Team:Brown
- 02:33, 20 October 2009 (diff | hist) N File:Histaminesensorbutton.gif
- 02:29, 20 October 2009 (diff | hist) Team:Brown
- 02:29, 20 October 2009 (diff | hist) N File:Alltogetherbutton.gif
- 02:25, 20 October 2009 (diff | hist) Team:Brown
- 02:25, 20 October 2009 (diff | hist) N File:Quorumbutton.gif (top)
- 02:19, 20 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:18, 20 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 02:17, 20 October 2009 (diff | hist) Team:Brown
- 02:17, 20 October 2009 (diff | hist) N File:Hbpbutton.gif
- 02:09, 20 October 2009 (diff | hist) Team:Brown
- 02:09, 20 October 2009 (diff | hist) Team:Brown
- 02:08, 20 October 2009 (diff | hist) N File:S.epibutton.gif
- 01:59, 20 October 2009 (diff | hist) Team:Brown
- 01:59, 20 October 2009 (diff | hist) N File:Implicationsbutton.gif
- 01:47, 20 October 2009 (diff | hist) Team:Brown
- 01:44, 20 October 2009 (diff | hist) Team:Brown
- 01:43, 20 October 2009 (diff | hist) Team:Brown
- 01:42, 20 October 2009 (diff | hist) Template:Brown
- 01:42, 20 October 2009 (diff | hist) N File:Learnmoreallergiesbutton.gif
- 01:35, 20 October 2009 (diff | hist) Template:Brown
- 01:33, 20 October 2009 (diff | hist) Team:Brown
- 01:26, 20 October 2009 (diff | hist) Team:Brown
- 01:24, 20 October 2009 (diff | hist) N File:Notebookbutton.gif
- 00:32, 20 October 2009 (diff | hist) Team:Brown
- 00:30, 20 October 2009 (diff | hist) N File:Partsbutton.gif
- 00:23, 20 October 2009 (diff | hist) Team:Brown
- 00:23, 20 October 2009 (diff | hist) Team:Brown
- 00:21, 20 October 2009 (diff | hist) N File:Teambutton.gif
- 16:25, 19 October 2009 (diff | hist) Team:Brown
- 16:22, 19 October 2009 (diff | hist) Team:Brown
- 16:22, 19 October 2009 (diff | hist) Team:Brown
- 16:21, 19 October 2009 (diff | hist) Team:Brown
- 16:19, 19 October 2009 (diff | hist) Team:Brown
- 16:01, 19 October 2009 (diff | hist) Team:Brown
- 16:01, 19 October 2009 (diff | hist) Team:Brown
- 16:00, 19 October 2009 (diff | hist) Team:Brown
- 15:59, 19 October 2009 (diff | hist) Team:Brown
- 15:58, 19 October 2009 (diff | hist) Team:Brown
- 15:58, 19 October 2009 (diff | hist) Team:Brown (→Welcome to the Brown iGEM wiki!)
- 15:57, 19 October 2009 (diff | hist) Team:Brown (→Welcome to the Brown iGEM wiki!)
- 15:56, 19 October 2009 (diff | hist) Team:Brown
- 15:53, 19 October 2009 (diff | hist) N File:Taz1-plasmid.gif (top)
- 15:36, 19 October 2009 (diff | hist) File:REV131-plasmid.gif (uploaded a new version of "Image:REV131-plasmid.gif") (top)
- 15:31, 19 October 2009 (diff | hist) N File:REV131-plasmid.gif
- 02:25, 19 October 2009 (diff | hist) Team:Brown/Team
- 02:22, 19 October 2009 (diff | hist) Template:Brown
- 02:18, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:17, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:16, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:16, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:15, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:15, 19 October 2009 (diff | hist) Team:Brown/Project Introduction
- 02:03, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:03, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:02, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:01, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 02:00, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:59, 19 October 2009 (diff | hist) N File:Mmdbimage.fcgi.png (top)
- 01:57, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:56, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:55, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:55, 19 October 2009 (diff | hist) Team:Brown/Project HBP
- 01:34, 19 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 01:34, 19 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 01:34, 19 October 2009 (diff | hist) Team:Brown/Project S.epidermidis
- 01:30, 19 October 2009 (diff | hist) Team:Brown/Project Histamine Sensor
- 01:26, 19 October 2009 (diff | hist) Template:Brown
- 01:24, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:24, 19 October 2009 (diff | hist) Team:Brown/Team Members (Replacing page with '{{Brown}} == ''''' ==') (top)
- 01:22, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:22, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:22, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:21, 19 October 2009 (diff | hist) Team:Brown/Team
- 01:03, 19 October 2009 (diff | hist) N Team:Brown/Notebook weekly Logs/Weekly Team2 Notebook (New page: <div style="background-color:black"> {{Brown}} <font><font color="white"> Team 2 Histamine Sensor Weekly Lab Log ---- ---- Week 6 ---- Jul 20, 09 Plan for the week: • Run...)
- 00:25, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:23, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:23, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:19, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:17, 19 October 2009 (diff | hist) Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook
- 00:16, 19 October 2009 (diff | hist) N Team:Brown/Notebook weekly Logs/Weekly Team1 Notebook (New page: Team 1 Histamine Binding Protein Weekly Lab Log ---- Week 3: June 29 – July 3, 2009 Monday Lab Meeting • Team 1 is working on digesting insert out of pBluescript using ECOR1 and BA...)
- 00:06, 19 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 00:06, 19 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 00:04, 19 October 2009 (diff | hist) N Team1Noteboook (New page: == Week 3: June 29 – July 3, 2009 == Monday Lab Meeting • Team 1 is working on digesting insert out of pBluescript using ECOR1 and BAMH1 • pVU2 Site→ use to analyze digest of plas...) (top)
- 00:02, 19 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 00:02, 19 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 23:59, 18 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 23:58, 18 October 2009 (diff | hist) Team:Brown/Notebook Weekly Logs
- 23:55, 18 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 23:54, 18 October 2009 (diff | hist) Team:Brown/Notebook Protocols
- 20:23, 18 October 2009 (diff | hist) Team:Brown/Parts
- 20:23, 18 October 2009 (diff | hist) Team:Brown/Parts
- 20:22, 18 October 2009 (diff | hist) N Team:Brown/Parts/OmpC (New page: tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggactaaagaggagaaaatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaa...)
- 20:22, 18 October 2009 (diff | hist) Team:Brown/Parts
- 20:20, 18 October 2009 (diff | hist) N Team:Brown/Parts/Tar-EnvZ (New page: ATGATTAACCGTATCCGCGTAGTCACGCTGTTGGTAATGGTGCTGGGGGTATTCGCACTGTTACAGCTTATTTCCGGCAGTCTGTTTTTTTCTTCCCTTCACCATAGCCAGAAGAGCTTTGTGGTTTCCAATCAATTACGGGAACAGCAGGGCGAGCTGACGTCAACCTGGGATTTAATGCTGCAAAC...)
- 20:15, 18 October 2009 (diff | hist) Team:Brown/Parts (Replacing page with '{{Brown}}')
- 20:12, 18 October 2009 (diff | hist) N Team:Brown/Notebook Recipes (New page: {{Brown}})
- 20:11, 18 October 2009 (diff | hist) N Team:Brown/Notebook Protocols (New page: {{Brown}})
- 20:11, 18 October 2009 (diff | hist) N Team:Brown/Notebook Weekly Logs (New page: {{Brown}})
- 20:10, 18 October 2009 (diff | hist) N Team:Brown/Project References (New page: {{Brown}}) (top)
- 20:10, 18 October 2009 (diff | hist) N Team:Brown/Project Histamine Sensor (New page: {{Brown}})
- 20:08, 18 October 2009 (diff | hist) N Team:Brown/Project S.epidermidis (New page: {{Brown}})
- 20:08, 18 October 2009 (diff | hist) N Team:Brown/Project HBP (New page: {{Brown}})
- 20:08, 18 October 2009 (diff | hist) N Team:Brown/Project Introduction (New page: {{Brown}})
- 20:07, 18 October 2009 (diff | hist) Team:Brown/Team Members
- 20:07, 18 October 2009 (diff | hist) Team:Brown/Team
- 20:04, 18 October 2009 (diff | hist) Template:Brown
- 20:03, 18 October 2009 (diff | hist) File:Allergenebanner09.jpg (uploaded a new version of "Image:Allergenebanner09.jpg") (top)
- 19:59, 18 October 2009 (diff | hist) Template:Brown
- 19:58, 18 October 2009 (diff | hist) Template:Brown
- 19:58, 18 October 2009 (diff | hist) Template:Brown
- 19:57, 18 October 2009 (diff | hist) Template:Brown
- 19:55, 18 October 2009 (diff | hist) Template:Brown
- 19:53, 18 October 2009 (diff | hist) Template:Brown
- 19:52, 18 October 2009 (diff | hist) Team:Brown
(Latest | Earliest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)